\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218907337:

Variant ID: vg1218907337 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18907337
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGATGTTTGATTTCTAACACTAAACTAAGATTTACAATATGAAACGGAGCGAGTACCATGAGATTTTCGCAAGACGATAACAATTACTTTTTTCTCAT[C/T]
AGCTCAATTTTCTCTACCTTTGAATACGGTTTGAATTATTGATTTATGTGATTGGAAATGAATAGTTATTTTGAAAAAAAAGCTATATAAATCAATCGAC

Reverse complement sequence

GTCGATTGATTTATATAGCTTTTTTTTCAAAATAACTATTCATTTCCAATCACATAAATCAATAATTCAAACCGTATTCAAAGGTAGAGAAAATTGAGCT[G/A]
ATGAGAAAAAAGTAATTGTTATCGTCTTGCGAAAATCTCATGGTACTCGCTCCGTTTCATATTGTAAATCTTAGTTTAGTGTTAGAAATCAAACATCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 46.90% 0.11% 0.00% NA
All Indica  2759 22.90% 76.90% 0.18% 0.00% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 12.80% 87.10% 0.17% 0.00% NA
Indica II  465 23.00% 77.00% 0.00% 0.00% NA
Indica III  913 23.40% 76.20% 0.33% 0.00% NA
Indica Intermediate  786 29.90% 70.00% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218907337 C -> T LOC_Os12g31440.1 upstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:38.83; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1218907337 C -> T LOC_Os12g31430.1 downstream_gene_variant ; 2672.0bp to feature; MODIFIER silent_mutation Average:38.83; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1218907337 C -> T LOC_Os12g31430-LOC_Os12g31440 intergenic_region ; MODIFIER silent_mutation Average:38.83; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218907337 NA 1.66E-29 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 5.30E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 9.77E-15 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 3.46E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 1.08E-12 1.39E-70 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 2.26E-09 1.97E-22 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 9.01E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 8.26E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 6.74E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 7.23E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 1.20E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 1.27E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 8.94E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 2.55E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 2.69E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 3.58E-07 4.81E-28 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 1.64E-06 3.48E-12 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 2.05E-15 5.04E-82 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 8.10E-16 9.65E-31 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 6.72E-10 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218907337 NA 1.08E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251