\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218887444:

Variant ID: vg1218887444 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18887444
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, T: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGGGCTGGGCATTTTGTCGAGCACCTTGAGTGCAATGAACAGTGTTTTCAGGAATTTTTGAATATTTTCCTAGAAAAGAATGAATTTAATCTATGAAT[A/T]
TGAAAGAGTTTCACTAGGGTTTGAAGTATAGCAAATCCTCACTAATATTAGGATAAACTAAGGAAATAATCTATGGTTTGAAATTTGAGAGAATTTGCTC

Reverse complement sequence

GAGCAAATTCTCTCAAATTTCAAACCATAGATTATTTCCTTAGTTTATCCTAATATTAGTGAGGATTTGCTATACTTCAAACCCTAGTGAAACTCTTTCA[T/A]
ATTCATAGATTAAATTCATTCTTTTCTAGGAAAATATTCAAAAATTCCTGAAAACACTGTTCATTGCACTCAAGGTGCTCGACAAAATGCCCAGCCCAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 33.90% 0.47% 1.33% NA
All Indica  2759 95.20% 3.40% 0.69% 0.65% NA
All Japonica  1512 7.60% 92.30% 0.07% 0.00% NA
Aus  269 91.10% 0.40% 0.00% 8.55% NA
Indica I  595 95.60% 3.40% 1.01% 0.00% NA
Indica II  465 97.20% 2.40% 0.00% 0.43% NA
Indica III  913 95.70% 2.40% 0.44% 1.42% NA
Indica Intermediate  786 93.10% 5.30% 1.15% 0.38% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 28.20% 71.40% 0.41% 0.00% NA
VI/Aromatic  96 21.90% 62.50% 0.00% 15.62% NA
Intermediate  90 33.30% 56.70% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218887444 A -> DEL N N silent_mutation Average:38.091; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1218887444 A -> T LOC_Os12g31400.1 upstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:38.091; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1218887444 A -> T LOC_Os12g31390.1 downstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:38.091; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1218887444 A -> T LOC_Os12g31390-LOC_Os12g31400 intergenic_region ; MODIFIER silent_mutation Average:38.091; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218887444 NA 9.01E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.59E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.61E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 9.44E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 2.27E-49 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 7.16E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 4.58E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.25E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 9.42E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 3.16E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.34E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.60E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 2.89E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 8.51E-07 1.41E-42 mr1601 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 9.44E-06 9.44E-06 mr1601 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.83E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.56E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 8.48E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.79E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.38E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.43E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 4.22E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 4.91E-34 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 8.83E-25 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 8.27E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 1.70E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 9.68E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.96E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218887444 NA 5.27E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251