Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218874242:

Variant ID: vg1218874242 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 18874242
Reference Allele: G	Alternative Allele: GAAAAA,A,GTCAAAAAAAA,GAAAA,GTAAAAAAA,GTCAAAAAAA
Primary Allele: G	Secondary Allele: GAAAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCCCCCCCACCGAAATGCTCACATCTCGCCCAAAAAAATTTGGTTTTTTGCAATTTTTTGTGAATTTGGTCAAATTTTATTCAAATTTATTCAAAATCT[G/GAAAAA,A,GTCAAAAAAAA,GAAAA,GTAAAAAAA,GTCAAAAAAA]
TCAAAAAAATTCAGTTCTATCGCCCACCTGCGGCAGAAATGTTGATTTCGAAATTTAAAAACCTGCACGAAACGTACTGTTCAGCAGTTTGAAAAATATG

Reverse complement sequence

CATATTTTTCAAACTGCTGAACAGTACGTTTCGTGCAGGTTTTTAAATTTCGAAATCAACATTTCTGCCGCAGGTGGGCGATAGAACTGAATTTTTTTGA[C/TTTTTC,T,TTTTTTTTGAC,TTTTC,TTTTTTTAC,TTTTTTTGAC]
AGATTTTGAATAAATTTGAATAAAATTTGACCAAATTCACAAAAAATTGCAAAAAACCAAATTTTTTTGGGCGAGATGTGAGCATTTCGGTGGGGGGGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of GAAAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	12.10%	24.35%	16.72%	A: 10.77%; GTCAAAAAAAA: 2.64%; GTAAAAAAA: 0.57%; GTCAAAAAAA: 0.17%; GAAAA: 0.11%
All Indica	2759	15.70%	20.30%	23.99%	21.13%	A: 13.56%; GTCAAAAAAAA: 4.39%; GTAAAAAAA: 0.62%; GTCAAAAAAA: 0.18%; GAAAA: 0.14%
All Japonica	1512	65.90%	0.30%	18.52%	9.79%	A: 5.36%; GTAAAAAAA: 0.07%; GTCAAAAAAAA: 0.07%
Aus	269	8.20%	0.40%	66.17%	8.18%	A: 15.99%; GTCAAAAAAAA: 0.74%; GTAAAAAAA: 0.37%
Indica I	595	16.30%	15.10%	39.33%	19.16%	A: 9.92%; GTCAAAAAAAA: 0.17%
Indica II	465	14.40%	17.40%	19.35%	26.88%	GTCAAAAAAAA: 17.63%; A: 4.09%; GTCAAAAAAA: 0.22%
Indica III	913	15.40%	28.90%	16.10%	18.51%	A: 18.29%; GTAAAAAAA: 1.31%; GTCAAAAAAAA: 0.77%; GAAAA: 0.44%; GTCAAAAAAA: 0.22%
Indica Intermediate	786	16.30%	15.90%	24.30%	22.26%	A: 16.41%; GTCAAAAAAAA: 3.94%; GTAAAAAAA: 0.64%; GTCAAAAAAA: 0.25%
Temperate Japonica	767	78.10%	0.30%	15.38%	5.61%	A: 0.65%
Tropical Japonica	504	52.80%	0.40%	24.40%	17.66%	A: 4.76%
Japonica Intermediate	241	54.40%	0.40%	16.18%	6.64%	A: 21.58%; GTAAAAAAA: 0.41%; GTCAAAAAAAA: 0.41%
VI/Aromatic	96	47.90%	2.10%	14.58%	23.96%	GTAAAAAAA: 8.33%; A: 3.12%
Intermediate	90	46.70%	4.40%	18.89%	15.56%	A: 8.89%; GTCAAAAAAA: 3.33%; GAAAA: 1.11%; GTCAAAAAAAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218874242	G -> A	LOC_Os12g31370.1	upstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> A	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTAAAAAAA	LOC_Os12g31370.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTAAAAAAA	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTCAAAAAAAA	LOC_Os12g31370.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTCAAAAAAAA	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTCAAAAAAA	LOC_Os12g31370.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GTCAAAAAAA	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GAAAAA	LOC_Os12g31370.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GAAAAA	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> DEL	N	N	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GAAAA	LOC_Os12g31370.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N
vg1218874242	G -> GAAAA	LOC_Os12g31350-LOC_Os12g31370	intergenic_region ; MODIFIER	silent_mutation	Average:26.887; most accessible tissue: Callus, score: 57.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218874242	5.36E-07	5.36E-07	mr1025	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218874242	NA	6.80E-06	mr1196	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218874242	NA	1.36E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218874242	2.38E-06	NA	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218874242	4.97E-06	NA	mr1368	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218874242	4.10E-06	NA	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251