\
| Variant ID: vg1218863509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18863509 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.23, others allele: 0.00, population size: 159. )
CTTGTGCTTTTGCCATTTATATTGAGCTCCACCTTGCTAGTAATAAATTACTATACCTATTGTTTTTCTATTTAACATGACATGAATGAATGAACAAATA[G/A]
CCACATTAAAATAACATTATGTTAACAGGGGCATGTGCTCCCATTCTTTTCTCTCCATTAAATATTATTGGGTCATAAGGGGCAATATGCCCCCTCTAAT
ATTAGAGGGGGCATATTGCCCCTTATGACCCAATAATATTTAATGGAGAGAAAAGAATGGGAGCACATGCCCCTGTTAACATAATGTTATTTTAATGTGG[C/T]
TATTTGTTCATTCATTCATGTCATGTTAAATAGAAAAACAATAGGTATAGTAATTTATTACTAGCAAGGTGGAGCTCAATATAAATGGCAAAAGCACAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 38.50% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 9.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 7.20% | 92.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.30% | 21.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 10.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 97.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 72.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 64.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218863509 | G -> A | LOC_Os12g31350.1 | upstream_gene_variant ; 2862.0bp to feature; MODIFIER | silent_mutation | Average:28.486; most accessible tissue: Callus, score: 78.828 | N | N | N | N |
| vg1218863509 | G -> A | LOC_Os12g31350-LOC_Os12g31370 | intergenic_region ; MODIFIER | silent_mutation | Average:28.486; most accessible tissue: Callus, score: 78.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218863509 | NA | 2.78E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 2.58E-08 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 4.11E-21 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 3.03E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 2.73E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 7.80E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 1.85E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 1.08E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | 1.34E-06 | 1.34E-06 | mr1750 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 9.35E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 9.35E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 1.77E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 1.83E-06 | mr1944 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | 3.10E-08 | 3.10E-08 | mr1987 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | NA | 8.53E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | 7.77E-06 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218863509 | 3.40E-08 | 2.99E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |