\
| Variant ID: vg1218852237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18852237 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 94. )
AGCGAAGCTCATGGACGGTGGTGTGCTGGAGCTCGCACCTGCTGATGGTGGCGATGTGGAGGGTATAAGAGAATCGGAAGAGGGATACCGGTGGAGGAGG[A/G]
GGCGGCGATGGTGGCGGCGGCGCACCGCCGCGGTTGCTGAGGAACTCGAGCTCCTGAAGGTTGTCGACGGCGGCGGATCGGAGCCAGGTATCCACGGTGT
ACACCGTGGATACCTGGCTCCGATCCGCCGCCGTCGACAACCTTCAGGAGCTCGAGTTCCTCAGCAACCGCGGCGGTGCGCCGCCGCCACCATCGCCGCC[T/C]
CCTCCTCCACCGGTATCCCTCTTCCGATTCTCTTATACCCTCCACATCGCCACCATCAGCAGGTGCGAGCTCCAGCACACCACCGTCCATGAGCTTCGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 37.30% | 0.15% | 2.58% | NA |
| All Indica | 2759 | 66.50% | 28.90% | 0.22% | 4.39% | NA |
| All Japonica | 1512 | 56.00% | 44.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.30% | 24.20% | 0.34% | 0.17% | NA |
| Indica II | 465 | 65.40% | 15.90% | 0.22% | 18.49% | NA |
| Indica III | 913 | 65.80% | 33.20% | 0.33% | 0.66% | NA |
| Indica Intermediate | 786 | 61.50% | 35.00% | 0.00% | 3.56% | NA |
| Temperate Japonica | 767 | 35.50% | 64.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.70% | 51.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218852237 | A -> DEL | LOC_Os12g31340.1 | N | frameshift_variant | Average:76.541; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg1218852237 | A -> G | LOC_Os12g31340.1 | synonymous_variant ; p.Pro174Pro; LOW | synonymous_codon | Average:76.541; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218852237 | NA | 6.20E-10 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 6.35E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | 6.28E-07 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 3.73E-14 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 8.19E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 4.01E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 4.60E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 1.88E-07 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | 2.61E-07 | NA | mr1457_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 2.09E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 9.32E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | 3.85E-09 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 1.09E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218852237 | NA | 1.70E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |