\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218850297:

Variant ID: vg1218850297 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18850297
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTATATATGGGTACCGACAACAAAGAAGACACTGAAATCATATATCAACTTCAATATTATTGCTATAACCAAGAGAGGTTCCCCAGAAACACATCT[A/G]
CCACTGCACACACGCAAAGAACAGATGGACATTGATTTCAGATTCAGAAAGAAACAAGAACAAACTGACACGGGATGACTCAAGCAAATTAGCTGTAGTT

Reverse complement sequence

AACTACAGCTAATTTGCTTGAGTCATCCCGTGTCAGTTTGTTCTTGTTTCTTTCTGAATCTGAAATCAATGTCCATCTGTTCTTTGCGTGTGTGCAGTGG[T/C]
AGATGTGTTTCTGGGGAACCTCTCTTGGTTATAGCAATAATATTGAAGTTGATATATGATTTCAGTGTCTTCTTTGTTGTCGGTACCCATATATAATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 35.10% 0.47% 1.50% NA
All Indica  2759 71.10% 27.40% 0.18% 1.23% NA
All Japonica  1512 56.30% 43.70% 0.00% 0.00% NA
Aus  269 16.70% 75.10% 2.97% 5.20% NA
Indica I  595 75.80% 24.20% 0.00% 0.00% NA
Indica II  465 84.10% 15.70% 0.00% 0.22% NA
Indica III  913 66.80% 30.10% 0.44% 2.63% NA
Indica Intermediate  786 65.00% 33.70% 0.13% 1.15% NA
Temperate Japonica  767 36.00% 64.00% 0.00% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 51.90% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 9.40% 4.17% 19.79% NA
Intermediate  90 54.40% 35.60% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218850297 A -> DEL N N silent_mutation Average:44.869; most accessible tissue: Callus, score: 86.276 N N N N
vg1218850297 A -> G LOC_Os12g31330.1 upstream_gene_variant ; 2676.0bp to feature; MODIFIER silent_mutation Average:44.869; most accessible tissue: Callus, score: 86.276 N N N N
vg1218850297 A -> G LOC_Os12g31320.1 downstream_gene_variant ; 4629.0bp to feature; MODIFIER silent_mutation Average:44.869; most accessible tissue: Callus, score: 86.276 N N N N
vg1218850297 A -> G LOC_Os12g31340.1 downstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:44.869; most accessible tissue: Callus, score: 86.276 N N N N
vg1218850297 A -> G LOC_Os12g31330-LOC_Os12g31340 intergenic_region ; MODIFIER silent_mutation Average:44.869; most accessible tissue: Callus, score: 86.276 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218850297 NA 4.75E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 6.62E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 5.36E-07 NA mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 1.06E-12 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 2.35E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 3.89E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 7.03E-09 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 9.22E-11 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297 NA 1.03E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251