\
| Variant ID: vg1218850297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18850297 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 173. )
AATATTATATATGGGTACCGACAACAAAGAAGACACTGAAATCATATATCAACTTCAATATTATTGCTATAACCAAGAGAGGTTCCCCAGAAACACATCT[A/G]
CCACTGCACACACGCAAAGAACAGATGGACATTGATTTCAGATTCAGAAAGAAACAAGAACAAACTGACACGGGATGACTCAAGCAAATTAGCTGTAGTT
AACTACAGCTAATTTGCTTGAGTCATCCCGTGTCAGTTTGTTCTTGTTTCTTTCTGAATCTGAAATCAATGTCCATCTGTTCTTTGCGTGTGTGCAGTGG[T/C]
AGATGTGTTTCTGGGGAACCTCTCTTGGTTATAGCAATAATATTGAAGTTGATATATGATTTCAGTGTCTTCTTTGTTGTCGGTACCCATATATAATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 35.10% | 0.47% | 1.50% | NA |
| All Indica | 2759 | 71.10% | 27.40% | 0.18% | 1.23% | NA |
| All Japonica | 1512 | 56.30% | 43.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.70% | 75.10% | 2.97% | 5.20% | NA |
| Indica I | 595 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.10% | 15.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 66.80% | 30.10% | 0.44% | 2.63% | NA |
| Indica Intermediate | 786 | 65.00% | 33.70% | 0.13% | 1.15% | NA |
| Temperate Japonica | 767 | 36.00% | 64.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 9.40% | 4.17% | 19.79% | NA |
| Intermediate | 90 | 54.40% | 35.60% | 5.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218850297 | A -> DEL | N | N | silent_mutation | Average:44.869; most accessible tissue: Callus, score: 86.276 | N | N | N | N |
| vg1218850297 | A -> G | LOC_Os12g31330.1 | upstream_gene_variant ; 2676.0bp to feature; MODIFIER | silent_mutation | Average:44.869; most accessible tissue: Callus, score: 86.276 | N | N | N | N |
| vg1218850297 | A -> G | LOC_Os12g31320.1 | downstream_gene_variant ; 4629.0bp to feature; MODIFIER | silent_mutation | Average:44.869; most accessible tissue: Callus, score: 86.276 | N | N | N | N |
| vg1218850297 | A -> G | LOC_Os12g31340.1 | downstream_gene_variant ; 768.0bp to feature; MODIFIER | silent_mutation | Average:44.869; most accessible tissue: Callus, score: 86.276 | N | N | N | N |
| vg1218850297 | A -> G | LOC_Os12g31330-LOC_Os12g31340 | intergenic_region ; MODIFIER | silent_mutation | Average:44.869; most accessible tissue: Callus, score: 86.276 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218850297 | NA | 4.75E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 6.62E-10 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | 5.36E-07 | NA | mr1458 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 1.06E-12 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 2.35E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 3.89E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | 7.03E-09 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 9.22E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218850297 | NA | 1.03E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |