Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218837930:

Variant ID: vg1218837930 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18837930
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTAAATAAAAAGAAAAACAATTAAAATCCCCCTCTTTCCTTTCGGGCCTCCTTTCGGCCCAAGTTCTCCCTTCTTTTGGGCCGGCCCAGCTCCTCCC[C/T]
CTCACTCTCCCGCAAGTCCTCATTGCCTCCCTCCATCGGCCTCCTCCCCCTTCTCTCGCCGACAAGTGGGACCACGGGGTCCACTCGTCAGCTTCTTCCC

Reverse complement sequence

GGGAAGAAGCTGACGAGTGGACCCCGTGGTCCCACTTGTCGGCGAGAGAAGGGGGAGGAGGCCGATGGAGGGAGGCAATGAGGACTTGCGGGAGAGTGAG[G/A]
GGGAGGAGCTGGGCCGGCCCAAAAGAAGGGAGAACTTGGGCCGAAAGGAGGCCCGAAAGGAAAGAGGGGGATTTTAATTGTTTTTCTTTTTATTTAATTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.40%	37.60%	0.21%	22.85%	NA
All Indica	2759	64.50%	8.90%	0.29%	26.31%	NA
All Japonica	1512	0.90%	93.00%	0.00%	6.15%	NA
Aus	269	16.70%	3.00%	0.37%	79.93%	NA
Indica I	595	73.10%	5.90%	0.00%	21.01%	NA
Indica II	465	65.40%	21.30%	0.22%	13.12%	NA
Indica III	913	64.40%	3.00%	0.33%	32.31%	NA
Indica Intermediate	786	57.60%	10.70%	0.51%	31.17%	NA
Temperate Japonica	767	0.90%	98.00%	0.00%	1.04%	NA
Tropical Japonica	504	0.80%	94.40%	0.00%	4.76%	NA
Japonica Intermediate	241	0.80%	73.90%	0.00%	25.31%	NA
VI/Aromatic	96	4.20%	62.50%	0.00%	33.33%	NA
Intermediate	90	20.00%	63.30%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218837930	C -> DEL	N	N	silent_mutation	Average:46.985; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1218837930	C -> T	LOC_Os12g31290.1	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:46.985; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1218837930	C -> T	LOC_Os12g31310.1	upstream_gene_variant ; 2174.0bp to feature; MODIFIER	silent_mutation	Average:46.985; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1218837930	C -> T	LOC_Os12g31300.1	downstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:46.985; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg1218837930	C -> T	LOC_Os12g31300-LOC_Os12g31310	intergenic_region ; MODIFIER	silent_mutation	Average:46.985; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218837930	NA	5.19E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	1.09E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	3.96E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	9.19E-10	2.67E-43	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	1.51E-08	5.04E-14	mr1458	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	8.53E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	7.45E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	1.03E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	1.42E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	NA	9.16E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	1.13E-06	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218837930	2.76E-07	1.94E-11	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251