\
| Variant ID: vg1218832355 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18832355 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, A: 0.18, others allele: 0.00, population size: 61. )
GGAGAATTAAAATTTCCTTTAAAAATCATTGGTCGGAAATATTTTGTAATATTCTATGTGCCCTAAAACACTCTCCGGATTTTTCCGTGAATTTTCGGAG[C/A]
TCAATAAATAATTTTAATGTCACAAAGTTCATTTAACCAATTAAATAAAAAGAAAAATAATTAAAATCCCCCTCTTTCCGTTCGGGCCTCCTTTCGGCCC
GGGCCGAAAGGAGGCCCGAACGGAAAGAGGGGGATTTTAATTATTTTTCTTTTTATTTAATTGGTTAAATGAACTTTGTGACATTAAAATTATTTATTGA[G/T]
CTCCGAAAATTCACGGAAAAATCCGGAGAGTGTTTTAGGGCACATAGAATATTACAAAATATTTCCGACCAATGATTTTTAAAGGAAATTTTAATTCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 31.80% | 4.00% | 25.86% | NA |
| All Indica | 2759 | 9.80% | 52.00% | 6.42% | 31.75% | NA |
| All Japonica | 1512 | 93.10% | 0.50% | 0.20% | 6.15% | NA |
| Aus | 269 | 4.80% | 15.60% | 0.74% | 78.81% | NA |
| Indica I | 595 | 7.90% | 54.30% | 12.94% | 24.87% | NA |
| Indica II | 465 | 22.80% | 55.90% | 4.73% | 16.56% | NA |
| Indica III | 913 | 3.20% | 52.50% | 3.83% | 40.53% | NA |
| Indica Intermediate | 786 | 11.30% | 47.50% | 5.47% | 35.75% | NA |
| Temperate Japonica | 767 | 98.00% | 0.40% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 94.40% | 0.60% | 0.20% | 4.76% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.80% | 0.00% | 24.48% | NA |
| VI/Aromatic | 96 | 64.60% | 3.10% | 4.17% | 28.12% | NA |
| Intermediate | 90 | 62.20% | 18.90% | 3.33% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218832355 | C -> DEL | N | N | silent_mutation | Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1218832355 | C -> A | LOC_Os12g31300.1 | upstream_gene_variant ; 2298.0bp to feature; MODIFIER | silent_mutation | Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1218832355 | C -> A | LOC_Os12g31290.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218832355 | NA | 1.92E-13 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | NA | 7.48E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | 8.62E-10 | 5.87E-49 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | 2.22E-08 | 2.48E-16 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | NA | 7.21E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | 7.67E-06 | 1.19E-18 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | NA | 5.05E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | 3.92E-08 | 4.52E-47 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218832355 | 5.33E-07 | 1.99E-13 | mr1458_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |