\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218832355:

Variant ID: vg1218832355 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18832355
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, A: 0.18, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAATTAAAATTTCCTTTAAAAATCATTGGTCGGAAATATTTTGTAATATTCTATGTGCCCTAAAACACTCTCCGGATTTTTCCGTGAATTTTCGGAG[C/A]
TCAATAAATAATTTTAATGTCACAAAGTTCATTTAACCAATTAAATAAAAAGAAAAATAATTAAAATCCCCCTCTTTCCGTTCGGGCCTCCTTTCGGCCC

Reverse complement sequence

GGGCCGAAAGGAGGCCCGAACGGAAAGAGGGGGATTTTAATTATTTTTCTTTTTATTTAATTGGTTAAATGAACTTTGTGACATTAAAATTATTTATTGA[G/T]
CTCCGAAAATTCACGGAAAAATCCGGAGAGTGTTTTAGGGCACATAGAATATTACAAAATATTTCCGACCAATGATTTTTAAAGGAAATTTTAATTCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 31.80% 4.00% 25.86% NA
All Indica  2759 9.80% 52.00% 6.42% 31.75% NA
All Japonica  1512 93.10% 0.50% 0.20% 6.15% NA
Aus  269 4.80% 15.60% 0.74% 78.81% NA
Indica I  595 7.90% 54.30% 12.94% 24.87% NA
Indica II  465 22.80% 55.90% 4.73% 16.56% NA
Indica III  913 3.20% 52.50% 3.83% 40.53% NA
Indica Intermediate  786 11.30% 47.50% 5.47% 35.75% NA
Temperate Japonica  767 98.00% 0.40% 0.26% 1.30% NA
Tropical Japonica  504 94.40% 0.60% 0.20% 4.76% NA
Japonica Intermediate  241 74.70% 0.80% 0.00% 24.48% NA
VI/Aromatic  96 64.60% 3.10% 4.17% 28.12% NA
Intermediate  90 62.20% 18.90% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218832355 C -> DEL N N silent_mutation Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1218832355 C -> A LOC_Os12g31300.1 upstream_gene_variant ; 2298.0bp to feature; MODIFIER silent_mutation Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1218832355 C -> A LOC_Os12g31290.1 intron_variant ; MODIFIER silent_mutation Average:40.263; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218832355 NA 1.92E-13 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 NA 7.48E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 8.62E-10 5.87E-49 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 2.22E-08 2.48E-16 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 NA 7.21E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 7.67E-06 1.19E-18 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 NA 5.05E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 3.92E-08 4.52E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218832355 5.33E-07 1.99E-13 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251