\
| Variant ID: vg1218796192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18796192 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATGGGGTACCCATAATATCCACAAAACCTATCTCAACCAAATTATTAAGGCCCTGTTTGTTTCAGTTTAAGATTATTGTAATCTAGATTGTTAAATCA[G/A]
ATTACTCTAAGCTGGATTATAATAAGCTGACATAAAATAAGCTATGTGTTGTTTGTTTCTCTGGATTATTAGAGACATTTAAGGGTAGTGAGTCTTTAGC
GCTAAAGACTCACTACCCTTAAATGTCTCTAATAATCCAGAGAAACAAACAACACATAGCTTATTTTATGTCAGCTTATTATAATCCAGCTTAGAGTAAT[C/T]
TGATTTAACAATCTAGATTACAATAATCTTAAACTGAAACAAACAGGGCCTTAATAATTTGGTTGAGATAGGTTTTGTGGATATTATGGGTACCCCATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 21.60% | 0.34% | 22.34% | NA |
| All Indica | 2759 | 70.90% | 3.10% | 0.40% | 25.59% | NA |
| All Japonica | 1512 | 38.10% | 55.70% | 0.20% | 6.02% | NA |
| Aus | 269 | 20.10% | 0.40% | 0.37% | 79.18% | NA |
| Indica I | 595 | 76.30% | 3.20% | 0.17% | 20.34% | NA |
| Indica II | 465 | 86.90% | 0.90% | 0.00% | 12.26% | NA |
| Indica III | 913 | 65.30% | 2.70% | 0.33% | 31.65% | NA |
| Indica Intermediate | 786 | 63.90% | 4.80% | 0.89% | 30.41% | NA |
| Temperate Japonica | 767 | 64.30% | 34.70% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 3.20% | 91.90% | 0.40% | 4.56% | NA |
| Japonica Intermediate | 241 | 27.80% | 46.90% | 0.00% | 25.31% | NA |
| VI/Aromatic | 96 | 6.20% | 61.50% | 0.00% | 32.29% | NA |
| Intermediate | 90 | 45.60% | 36.70% | 1.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218796192 | G -> DEL | N | N | silent_mutation | Average:31.048; most accessible tissue: Callus, score: 59.294 | N | N | N | N |
| vg1218796192 | G -> A | LOC_Os12g31210.1 | upstream_gene_variant ; 3410.0bp to feature; MODIFIER | silent_mutation | Average:31.048; most accessible tissue: Callus, score: 59.294 | N | N | N | N |
| vg1218796192 | G -> A | LOC_Os12g31210-LOC_Os12g31230 | intergenic_region ; MODIFIER | silent_mutation | Average:31.048; most accessible tissue: Callus, score: 59.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218796192 | NA | 5.10E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 8.74E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 7.69E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 1.83E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 2.21E-07 | mr1729 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 5.97E-09 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 2.45E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 2.45E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 1.46E-06 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 1.89E-12 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 5.89E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 2.65E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 6.88E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 3.61E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218796192 | NA | 8.53E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |