\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218772233:

Variant ID: vg1218772233 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18772233
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.08, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


GGACCCCCCTTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCTAACGGAATATGCATATACAGATAAAATACAGTCGTGACCGACTA[G/A]
ATCTCAAGGTATTTCCTTGACGTACAAGTTAAGAAACAAACCCGAGATACACATAAGATATTCTATCTATATTCGGTATCCTATATTCAGTCCAAATATC

Reverse complement sequence

GATATTTGGACTGAATATAGGATACCGAATATAGATAGAATATCTTATGTGTATCTCGGGTTTGTTTCTTAACTTGTACGTCAAGGAAATACCTTGAGAT[C/T]
TAGTCGGTCACGACTGTATTTTATCTGTATATGCATATTCCGTTAGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAAGGGGGGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.10% 6.20% 40.88% 36.84% NA
All Indica  2759 4.30% 8.50% 34.07% 53.06% NA
All Japonica  1512 39.40% 1.70% 42.79% 16.14% NA
Aus  269 5.90% 8.20% 82.53% 3.35% NA
Indica I  595 6.10% 2.90% 23.70% 67.39% NA
Indica II  465 3.90% 5.40% 21.72% 69.03% NA
Indica III  913 0.30% 12.90% 46.77% 39.98% NA
Indica Intermediate  786 8.00% 9.50% 34.48% 47.96% NA
Temperate Japonica  767 66.00% 0.10% 10.17% 23.73% NA
Tropical Japonica  504 4.60% 3.20% 84.52% 7.74% NA
Japonica Intermediate  241 27.80% 3.30% 59.34% 9.54% NA
VI/Aromatic  96 2.10% 7.30% 86.46% 4.17% NA
Intermediate  90 30.00% 3.30% 44.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218772233 G -> DEL N N silent_mutation Average:23.981; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1218772233 G -> A LOC_Os12g31180.1 upstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:23.981; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1218772233 G -> A LOC_Os12g31190.1 downstream_gene_variant ; 4416.0bp to feature; MODIFIER silent_mutation Average:23.981; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg1218772233 G -> A LOC_Os12g31160-LOC_Os12g31180 intergenic_region ; MODIFIER silent_mutation Average:23.981; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218772233 NA 2.23E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 1.07E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 4.19E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 6.09E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 2.09E-08 mr1851 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 6.96E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 9.80E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 3.48E-08 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 2.24E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 1.76E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 9.96E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 1.12E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 5.77E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218772233 NA 1.31E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251