\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218769925:

Variant ID: vg1218769925 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18769925
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, T: 0.13, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATGGCTCCAGAGATTGCCCCTTCTGCTAGCAGCGATAGTGAACGGCGCTCTAGATCTTGCTCTGATACCTCGAAGGTTTGTATGAGAAGTGTACAGT[A/T]
TGATTGGATTGATTGTTTTGATCTTCAGGAACTATTTTTGACAAAAAGAAATACATAAGAGTGATCTAAACTTTCGAGGGGATGTCCCCTCGTCAAATGC

Reverse complement sequence

GCATTTGACGAGGGGACATCCCCTCGAAAGTTTAGATCACTCTTATGTATTTCTTTTTGTCAAAAATAGTTCCTGAAGATCAAAACAATCAATCCAATCA[T/A]
ACTGTACACTTCTCATACAAACCTTCGAGGTATCAGAGCAAGATCTAGAGCGCCGTTCACTATCGCTGCTAGCAGAAGGGGCAATCTCTGGAGCCATTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 38.00% 0.30% 22.56% NA
All Indica  2759 12.10% 63.50% 0.40% 23.99% NA
All Japonica  1512 88.00% 1.10% 0.13% 10.78% NA
Aus  269 23.80% 2.60% 0.37% 73.23% NA
Indica I  595 9.10% 73.60% 0.34% 16.97% NA
Indica II  465 23.20% 65.60% 0.43% 10.75% NA
Indica III  913 6.80% 60.90% 0.00% 32.31% NA
Indica Intermediate  786 14.00% 57.60% 0.89% 27.48% NA
Temperate Japonica  767 88.30% 1.60% 0.13% 10.04% NA
Tropical Japonica  504 95.00% 0.40% 0.20% 4.37% NA
Japonica Intermediate  241 72.60% 0.80% 0.00% 26.56% NA
VI/Aromatic  96 67.70% 2.10% 0.00% 30.21% NA
Intermediate  90 63.30% 20.00% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218769925 A -> DEL N N silent_mutation Average:27.941; most accessible tissue: Callus, score: 58.475 N N N N
vg1218769925 A -> T LOC_Os12g31180.1 upstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:27.941; most accessible tissue: Callus, score: 58.475 N N N N
vg1218769925 A -> T LOC_Os12g31160-LOC_Os12g31180 intergenic_region ; MODIFIER silent_mutation Average:27.941; most accessible tissue: Callus, score: 58.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218769925 NA 3.40E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 6.88E-06 7.37E-45 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 1.87E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 9.20E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 7.75E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 1.64E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 6.65E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 1.48E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 4.66E-19 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 2.58E-50 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 1.04E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 8.92E-07 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 9.24E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 5.46E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 6.47E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769925 NA 2.92E-06 mr1930_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251