Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218769254:

Variant ID: vg1218769254 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18769254
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.45, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TACAATTAGAAATAATAAAAATTCAGAATAAAAATAAATAATATTGGAAGAAGAGCATAGAGTCTGTAAAAATACAATTTAGAGAAAATTCGGAATTAAA[T/A]
AAAAGAAATATTAAAAGATGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAATTTGATATTAAAAATAATTAATAACTAACACATA

Reverse complement sequence

TATGTGTTAGTTATTAATTATTTTTAATATCAAATTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCATCTTTTAATATTTCTTTT[A/T]
TTTAATTCCGAATTTTCTCTAAATTGTATTTTTACAGACTCTATGCTCTTCTTCCAATATTATTTATTTTTATTCTGAATTTTTATTATTTCTAATTGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	35.30%	0.32%	22.96%	NA
All Indica	2759	67.90%	7.20%	0.22%	24.61%	NA
All Japonica	1512	1.10%	87.70%	0.33%	10.91%	NA
Aus	269	17.80%	8.60%	0.74%	72.86%	NA
Indica I	595	73.60%	8.60%	0.17%	17.65%	NA
Indica II	465	83.40%	4.70%	0.22%	11.61%	NA
Indica III	913	63.40%	4.10%	0.22%	32.31%	NA
Indica Intermediate	786	59.70%	11.50%	0.25%	28.63%	NA
Temperate Japonica	767	1.20%	88.40%	0.39%	10.04%	NA
Tropical Japonica	504	0.80%	94.40%	0.20%	4.56%	NA
Japonica Intermediate	241	1.20%	71.40%	0.41%	26.97%	NA
VI/Aromatic	96	3.10%	65.60%	0.00%	31.25%	NA
Intermediate	90	20.00%	61.10%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218769254	T -> DEL	N	N	silent_mutation	Average:12.028; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg1218769254	T -> A	LOC_Os12g31180.1	upstream_gene_variant ; 4139.0bp to feature; MODIFIER	silent_mutation	Average:12.028; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg1218769254	T -> A	LOC_Os12g31160-LOC_Os12g31180	intergenic_region ; MODIFIER	silent_mutation	Average:12.028; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218769254	NA	1.99E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769254	4.23E-06	4.23E-06	mr1455_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218769254	NA	1.15E-10	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251