\
| Variant ID: vg1218769254 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18769254 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, A: 0.45, others allele: 0.00, population size: 51. )
TACAATTAGAAATAATAAAAATTCAGAATAAAAATAAATAATATTGGAAGAAGAGCATAGAGTCTGTAAAAATACAATTTAGAGAAAATTCGGAATTAAA[T/A]
AAAAGAAATATTAAAAGATGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACTAAATTTGATATTAAAAATAATTAATAACTAACACATA
TATGTGTTAGTTATTAATTATTTTTAATATCAAATTTAGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCATCTTTTAATATTTCTTTT[A/T]
TTTAATTCCGAATTTTCTCTAAATTGTATTTTTACAGACTCTATGCTCTTCTTCCAATATTATTTATTTTTATTCTGAATTTTTATTATTTCTAATTGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 35.30% | 0.32% | 22.96% | NA |
| All Indica | 2759 | 67.90% | 7.20% | 0.22% | 24.61% | NA |
| All Japonica | 1512 | 1.10% | 87.70% | 0.33% | 10.91% | NA |
| Aus | 269 | 17.80% | 8.60% | 0.74% | 72.86% | NA |
| Indica I | 595 | 73.60% | 8.60% | 0.17% | 17.65% | NA |
| Indica II | 465 | 83.40% | 4.70% | 0.22% | 11.61% | NA |
| Indica III | 913 | 63.40% | 4.10% | 0.22% | 32.31% | NA |
| Indica Intermediate | 786 | 59.70% | 11.50% | 0.25% | 28.63% | NA |
| Temperate Japonica | 767 | 1.20% | 88.40% | 0.39% | 10.04% | NA |
| Tropical Japonica | 504 | 0.80% | 94.40% | 0.20% | 4.56% | NA |
| Japonica Intermediate | 241 | 1.20% | 71.40% | 0.41% | 26.97% | NA |
| VI/Aromatic | 96 | 3.10% | 65.60% | 0.00% | 31.25% | NA |
| Intermediate | 90 | 20.00% | 61.10% | 2.22% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218769254 | T -> DEL | N | N | silent_mutation | Average:12.028; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| vg1218769254 | T -> A | LOC_Os12g31180.1 | upstream_gene_variant ; 4139.0bp to feature; MODIFIER | silent_mutation | Average:12.028; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| vg1218769254 | T -> A | LOC_Os12g31160-LOC_Os12g31180 | intergenic_region ; MODIFIER | silent_mutation | Average:12.028; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218769254 | NA | 1.99E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218769254 | 4.23E-06 | 4.23E-06 | mr1455_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218769254 | NA | 1.15E-10 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |