\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218760084:

Variant ID: vg1218760084 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18760084
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.34, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCAGGGCAGCCTGGCGATTTCCTGTTCAGCATACCGGCAATGACGATCATCGCTAGTGGCATGCCGCCGCATATGTTCCAAACATCATGGAAAACC[C/A,T]
CTTCTTCCAGGTCAGTCTCAGAAGAGTAAATTTTCTTAGGAGACTGCAGTCTGCCGAGAAACAGTTGCTTGGAGTCAGTCTTGCTAAGATGCTTCATCGG

Reverse complement sequence

CCGATGAAGCATCTTAGCAAGACTGACTCCAAGCAACTGTTTCTCGGCAGACTGCAGTCTCCTAAGAAAATTTACTCTTCTGAGACTGACCTGGAAGAAG[G/T,A]
GGTTTTCCATGATGTTTGGAACATATGCGGCGGCATGCCACTAGCGATGATCGTCATTGCCGGTATGCTGAACAGGAAATCGCCAGGCTGCCCTGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.70% 35.30% 0.78% 21.52% T: 0.70%
All Indica  2759 68.20% 7.20% 1.12% 22.51% T: 0.94%
All Japonica  1512 1.20% 87.90% 0.13% 10.38% T: 0.40%
Aus  269 17.80% 8.60% 0.74% 72.86% NA
Indica I  595 73.60% 8.60% 0.34% 16.64% T: 0.84%
Indica II  465 83.00% 5.60% 1.29% 9.89% T: 0.22%
Indica III  913 64.60% 3.20% 1.64% 29.46% T: 1.10%
Indica Intermediate  786 59.50% 11.80% 1.02% 26.34% T: 1.27%
Temperate Japonica  767 1.60% 88.40% 0.13% 9.91% NA
Tropical Japonica  504 0.40% 95.00% 0.00% 4.56% NA
Japonica Intermediate  241 1.70% 71.40% 0.41% 24.07% T: 2.49%
VI/Aromatic  96 3.10% 64.60% 2.08% 29.17% T: 1.04%
Intermediate  90 20.00% 63.30% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218760084 C -> DEL LOC_Os12g31160.1 N frameshift_variant Average:64.339; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg1218760084 C -> A LOC_Os12g31160.1 missense_variant ; p.Gly354Val; MODERATE nonsynonymous_codon ; G354V Average:64.339; most accessible tissue: Zhenshan97 young leaf, score: 82.31 unknown unknown TOLERATED 0.33
vg1218760084 C -> T LOC_Os12g31160.1 missense_variant ; p.Gly354Glu; MODERATE nonsynonymous_codon ; G354Q Average:64.339; most accessible tissue: Zhenshan97 young leaf, score: 82.31 unknown unknown TOLERATED 0.60
vg1218760084 C -> T LOC_Os12g31160.1 missense_variant ; p.Gly354Glu; MODERATE nonsynonymous_codon ; G354E Average:64.339; most accessible tissue: Zhenshan97 young leaf, score: 82.31 unknown unknown TOLERATED 0.93

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218760084 NA 8.74E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 7.09E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 1.54E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 1.11E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 6.09E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 2.33E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 3.52E-22 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 7.31E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 2.61E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 2.45E-08 5.38E-07 mr1334 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 5.54E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 3.71E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 1.12E-07 NA mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 6.58E-06 NA mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 3.85E-39 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 9.30E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 3.95E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 4.10E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 1.63E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 1.43E-37 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 6.04E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 2.25E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 8.06E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 1.76E-07 NA mr1987 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 1.35E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 9.37E-25 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 3.94E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218760084 NA 5.32E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251