\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218733502:

Variant ID: vg1218733502 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18733502
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.12, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TCTATTTGGTTCTGCATGATGTCCAGCAGGACAAACTTCTAGATACCTGGATGCCCAGTAAAACGGCAAATCAATCAAAAGTAAGCACAAATGAACAATA[C/A]
ACAGTAATACGAATGTTGTGACATGAATCATACGTTTTTTTTTATGATCATGGTTGCAACTAAACACACATTTGTATCCCTTGCTCGCTACCAGCGAATC

Reverse complement sequence

GATTCGCTGGTAGCGAGCAAGGGATACAAATGTGTGTTTAGTTGCAACCATGATCATAAAAAAAAACGTATGATTCATGTCACAACATTCGTATTACTGT[G/T]
TATTGTTCATTTGTGCTTACTTTTGATTGATTTGCCGTTTTACTGGGCATCCAGGTATCTAGAAGTTTGTCCTGCTGGACATCATGCAGAACCAAATAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 38.20% 0.32% 20.80% NA
All Indica  2759 11.50% 64.10% 0.33% 24.07% NA
All Japonica  1512 93.70% 0.80% 0.07% 5.49% NA
Aus  269 24.50% 3.00% 1.49% 71.00% NA
Indica I  595 8.40% 73.80% 0.50% 17.31% NA
Indica II  465 23.20% 66.00% 0.00% 10.75% NA
Indica III  913 5.50% 62.40% 0.33% 31.76% NA
Indica Intermediate  786 14.00% 57.50% 0.38% 28.12% NA
Temperate Japonica  767 98.30% 1.20% 0.00% 0.52% NA
Tropical Japonica  504 95.20% 0.20% 0.00% 4.56% NA
Japonica Intermediate  241 75.50% 0.80% 0.41% 23.24% NA
VI/Aromatic  96 64.60% 2.10% 0.00% 33.33% NA
Intermediate  90 65.60% 18.90% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218733502 C -> DEL N N silent_mutation Average:38.716; most accessible tissue: Callus, score: 85.993 N N N N
vg1218733502 C -> A LOC_Os12g31130.1 intron_variant ; MODIFIER silent_mutation Average:38.716; most accessible tissue: Callus, score: 85.993 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218733502 NA 9.25E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 NA 6.10E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 NA 6.10E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 1.58E-06 NA mr1872 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 NA 1.39E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 NA 9.11E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218733502 NA 7.99E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251