\
| Variant ID: vg1218733502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18733502 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.12, others allele: 0.00, population size: 59. )
TCTATTTGGTTCTGCATGATGTCCAGCAGGACAAACTTCTAGATACCTGGATGCCCAGTAAAACGGCAAATCAATCAAAAGTAAGCACAAATGAACAATA[C/A]
ACAGTAATACGAATGTTGTGACATGAATCATACGTTTTTTTTTATGATCATGGTTGCAACTAAACACACATTTGTATCCCTTGCTCGCTACCAGCGAATC
GATTCGCTGGTAGCGAGCAAGGGATACAAATGTGTGTTTAGTTGCAACCATGATCATAAAAAAAAACGTATGATTCATGTCACAACATTCGTATTACTGT[G/T]
TATTGTTCATTTGTGCTTACTTTTGATTGATTTGCCGTTTTACTGGGCATCCAGGTATCTAGAAGTTTGTCCTGCTGGACATCATGCAGAACCAAATAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.60% | 38.20% | 0.32% | 20.80% | NA |
| All Indica | 2759 | 11.50% | 64.10% | 0.33% | 24.07% | NA |
| All Japonica | 1512 | 93.70% | 0.80% | 0.07% | 5.49% | NA |
| Aus | 269 | 24.50% | 3.00% | 1.49% | 71.00% | NA |
| Indica I | 595 | 8.40% | 73.80% | 0.50% | 17.31% | NA |
| Indica II | 465 | 23.20% | 66.00% | 0.00% | 10.75% | NA |
| Indica III | 913 | 5.50% | 62.40% | 0.33% | 31.76% | NA |
| Indica Intermediate | 786 | 14.00% | 57.50% | 0.38% | 28.12% | NA |
| Temperate Japonica | 767 | 98.30% | 1.20% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 95.20% | 0.20% | 0.00% | 4.56% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.80% | 0.41% | 23.24% | NA |
| VI/Aromatic | 96 | 64.60% | 2.10% | 0.00% | 33.33% | NA |
| Intermediate | 90 | 65.60% | 18.90% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218733502 | C -> DEL | N | N | silent_mutation | Average:38.716; most accessible tissue: Callus, score: 85.993 | N | N | N | N |
| vg1218733502 | C -> A | LOC_Os12g31130.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.716; most accessible tissue: Callus, score: 85.993 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218733502 | NA | 9.25E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | NA | 6.10E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | NA | 6.10E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | 1.58E-06 | NA | mr1872 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | NA | 1.39E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | NA | 9.11E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218733502 | NA | 7.99E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |