\
| Variant ID: vg1218731778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18731778 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 59. )
ATTGAGAAAAGAATAGATCATCGGTTTTATTTAAATCATTTAGATAAAATAAAAAAAAACAGCCCTCCAGTTCACCCTCCTCCCAAACATACACACAACA[C/T]
GGCATTACTCGACCCATACCTTCTTGTCTTGACCTCCCACTCTACCACTTCCTGTTTATATAAGCAAAAGTAATCAAAAATATTAATACATGCATAAATT
AATTTATGCATGTATTAATATTTTTGATTACTTTTGCTTATATAAACAGGAAGTGGTAGAGTGGGAGGTCAAGACAAGAAGGTATGGGTCGAGTAATGCC[G/A]
TGTTGTGTGTATGTTTGGGAGGAGGGTGAACTGGAGGGCTGTTTTTTTTTATTTTATCTAAATGATTTAAATAAAACCGATGATCTATTCTTTTCTCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.40% | 38.70% | 0.63% | 20.36% | NA |
| All Indica | 2759 | 11.00% | 64.80% | 0.91% | 23.27% | NA |
| All Japonica | 1512 | 93.60% | 0.80% | 0.07% | 5.56% | NA |
| Aus | 269 | 24.90% | 3.00% | 1.49% | 70.63% | NA |
| Indica I | 595 | 8.60% | 73.80% | 0.50% | 17.14% | NA |
| Indica II | 465 | 23.40% | 65.80% | 0.22% | 10.54% | NA |
| Indica III | 913 | 3.40% | 64.60% | 1.53% | 30.45% | NA |
| Indica Intermediate | 786 | 14.40% | 57.60% | 0.89% | 27.10% | NA |
| Temperate Japonica | 767 | 98.30% | 1.20% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 95.20% | 0.20% | 0.00% | 4.56% | NA |
| Japonica Intermediate | 241 | 75.10% | 0.80% | 0.41% | 23.65% | NA |
| VI/Aromatic | 96 | 64.60% | 2.10% | 0.00% | 33.33% | NA |
| Intermediate | 90 | 65.60% | 18.90% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218731778 | C -> DEL | N | N | silent_mutation | Average:23.922; most accessible tissue: Callus, score: 43.366 | N | N | N | N |
| vg1218731778 | C -> T | LOC_Os12g31130.1 | downstream_gene_variant ; 1545.0bp to feature; MODIFIER | silent_mutation | Average:23.922; most accessible tissue: Callus, score: 43.366 | N | N | N | N |
| vg1218731778 | C -> T | LOC_Os12g31120-LOC_Os12g31130 | intergenic_region ; MODIFIER | silent_mutation | Average:23.922; most accessible tissue: Callus, score: 43.366 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218731778 | NA | 3.39E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 1.62E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 1.19E-20 | mr1254 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 9.19E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 3.00E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 3.00E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 1.14E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 8.25E-06 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 1.47E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731778 | NA | 5.41E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |