\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218731778:

Variant ID: vg1218731778 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18731778
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGAGAAAAGAATAGATCATCGGTTTTATTTAAATCATTTAGATAAAATAAAAAAAAACAGCCCTCCAGTTCACCCTCCTCCCAAACATACACACAACA[C/T]
GGCATTACTCGACCCATACCTTCTTGTCTTGACCTCCCACTCTACCACTTCCTGTTTATATAAGCAAAAGTAATCAAAAATATTAATACATGCATAAATT

Reverse complement sequence

AATTTATGCATGTATTAATATTTTTGATTACTTTTGCTTATATAAACAGGAAGTGGTAGAGTGGGAGGTCAAGACAAGAAGGTATGGGTCGAGTAATGCC[G/A]
TGTTGTGTGTATGTTTGGGAGGAGGGTGAACTGGAGGGCTGTTTTTTTTTATTTTATCTAAATGATTTAAATAAAACCGATGATCTATTCTTTTCTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 38.70% 0.63% 20.36% NA
All Indica  2759 11.00% 64.80% 0.91% 23.27% NA
All Japonica  1512 93.60% 0.80% 0.07% 5.56% NA
Aus  269 24.90% 3.00% 1.49% 70.63% NA
Indica I  595 8.60% 73.80% 0.50% 17.14% NA
Indica II  465 23.40% 65.80% 0.22% 10.54% NA
Indica III  913 3.40% 64.60% 1.53% 30.45% NA
Indica Intermediate  786 14.40% 57.60% 0.89% 27.10% NA
Temperate Japonica  767 98.30% 1.20% 0.00% 0.52% NA
Tropical Japonica  504 95.20% 0.20% 0.00% 4.56% NA
Japonica Intermediate  241 75.10% 0.80% 0.41% 23.65% NA
VI/Aromatic  96 64.60% 2.10% 0.00% 33.33% NA
Intermediate  90 65.60% 18.90% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218731778 C -> DEL N N silent_mutation Average:23.922; most accessible tissue: Callus, score: 43.366 N N N N
vg1218731778 C -> T LOC_Os12g31130.1 downstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:23.922; most accessible tissue: Callus, score: 43.366 N N N N
vg1218731778 C -> T LOC_Os12g31120-LOC_Os12g31130 intergenic_region ; MODIFIER silent_mutation Average:23.922; most accessible tissue: Callus, score: 43.366 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218731778 NA 3.39E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 1.62E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 1.19E-20 mr1254 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 9.19E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 3.00E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 3.00E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 1.14E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 8.25E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 1.47E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778 NA 5.41E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251