Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218731778:

Variant ID: vg1218731778 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18731778
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGAGAAAAGAATAGATCATCGGTTTTATTTAAATCATTTAGATAAAATAAAAAAAAACAGCCCTCCAGTTCACCCTCCTCCCAAACATACACACAACA[C/T]
GGCATTACTCGACCCATACCTTCTTGTCTTGACCTCCCACTCTACCACTTCCTGTTTATATAAGCAAAAGTAATCAAAAATATTAATACATGCATAAATT

Reverse complement sequence

AATTTATGCATGTATTAATATTTTTGATTACTTTTGCTTATATAAACAGGAAGTGGTAGAGTGGGAGGTCAAGACAAGAAGGTATGGGTCGAGTAATGCC[G/A]
TGTTGTGTGTATGTTTGGGAGGAGGGTGAACTGGAGGGCTGTTTTTTTTTATTTTATCTAAATGATTTAAATAAAACCGATGATCTATTCTTTTCTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	38.70%	0.63%	20.36%	NA
All Indica	2759	11.00%	64.80%	0.91%	23.27%	NA
All Japonica	1512	93.60%	0.80%	0.07%	5.56%	NA
Aus	269	24.90%	3.00%	1.49%	70.63%	NA
Indica I	595	8.60%	73.80%	0.50%	17.14%	NA
Indica II	465	23.40%	65.80%	0.22%	10.54%	NA
Indica III	913	3.40%	64.60%	1.53%	30.45%	NA
Indica Intermediate	786	14.40%	57.60%	0.89%	27.10%	NA
Temperate Japonica	767	98.30%	1.20%	0.00%	0.52%	NA
Tropical Japonica	504	95.20%	0.20%	0.00%	4.56%	NA
Japonica Intermediate	241	75.10%	0.80%	0.41%	23.65%	NA
VI/Aromatic	96	64.60%	2.10%	0.00%	33.33%	NA
Intermediate	90	65.60%	18.90%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218731778	C -> DEL	N	N	silent_mutation	Average:23.922; most accessible tissue: Callus, score: 43.366	N	N	N	N
vg1218731778	C -> T	LOC_Os12g31130.1	downstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:23.922; most accessible tissue: Callus, score: 43.366	N	N	N	N
vg1218731778	C -> T	LOC_Os12g31120-LOC_Os12g31130	intergenic_region ; MODIFIER	silent_mutation	Average:23.922; most accessible tissue: Callus, score: 43.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218731778	NA	3.39E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	1.62E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	1.19E-20	mr1254	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	9.19E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	3.00E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	3.00E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	1.14E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	8.25E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	1.47E-15	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731778	NA	5.41E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251