\
| Variant ID: vg1218731515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18731515 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATAGAAAAAAGACAGACCATAATACAAAATGAAAATAAGTATTATATTATCATAAATCATTGTACATCCTCTGAGAGCACTTAAGGCATCACGTGTTAC[G/A]
CCTTAAATAAAAATAAAACTTTACAAATTGGAAGAAAAATCATCTGACCATCAGTTTCAACTTAAATAGGTAGATCTATTATTTTCAACCAACAGATATA
TATATCTGTTGGTTGAAAATAATAGATCTACCTATTTAAGTTGAAACTGATGGTCAGATGATTTTTCTTCCAATTTGTAAAGTTTTATTTTTATTTAAGG[C/T]
GTAACACGTGATGCCTTAAGTGCTCTCAGAGGATGTACAATGATTTATGATAATATAATACTTATTTTCATTTTGTATTATGGTCTGTCTTTTTTCTATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 0.40% | 8.32% | 8.80% | NA |
| All Indica | 2759 | 78.60% | 0.70% | 12.00% | 8.70% | NA |
| All Japonica | 1512 | 95.00% | 0.00% | 1.72% | 3.24% | NA |
| Aus | 269 | 52.40% | 0.00% | 8.55% | 39.03% | NA |
| Indica I | 595 | 84.70% | 0.50% | 8.57% | 6.22% | NA |
| Indica II | 465 | 90.80% | 0.40% | 4.52% | 4.30% | NA |
| Indica III | 913 | 70.30% | 1.20% | 17.63% | 10.84% | NA |
| Indica Intermediate | 786 | 76.50% | 0.40% | 12.47% | 10.69% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 96.00% | 0.00% | 0.79% | 3.17% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.00% | 9.13% | 12.86% | NA |
| VI/Aromatic | 96 | 74.00% | 2.10% | 10.42% | 13.54% | NA |
| Intermediate | 90 | 86.70% | 0.00% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218731515 | G -> DEL | N | N | silent_mutation | Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1218731515 | G -> A | LOC_Os12g31130.1 | downstream_gene_variant ; 1808.0bp to feature; MODIFIER | silent_mutation | Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg1218731515 | G -> A | LOC_Os12g31120-LOC_Os12g31130 | intergenic_region ; MODIFIER | silent_mutation | Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218731515 | NA | 4.07E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | 8.33E-07 | 4.28E-08 | mr1171 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | NA | 1.65E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | NA | 7.11E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | NA | 8.50E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | NA | 4.01E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218731515 | NA | 4.96E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |