\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218731515:

Variant ID: vg1218731515 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18731515
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAGAAAAAAGACAGACCATAATACAAAATGAAAATAAGTATTATATTATCATAAATCATTGTACATCCTCTGAGAGCACTTAAGGCATCACGTGTTAC[G/A]
CCTTAAATAAAAATAAAACTTTACAAATTGGAAGAAAAATCATCTGACCATCAGTTTCAACTTAAATAGGTAGATCTATTATTTTCAACCAACAGATATA

Reverse complement sequence

TATATCTGTTGGTTGAAAATAATAGATCTACCTATTTAAGTTGAAACTGATGGTCAGATGATTTTTCTTCCAATTTGTAAAGTTTTATTTTTATTTAAGG[C/T]
GTAACACGTGATGCCTTAAGTGCTCTCAGAGGATGTACAATGATTTATGATAATATAATACTTATTTTCATTTTGTATTATGGTCTGTCTTTTTTCTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 0.40% 8.32% 8.80% NA
All Indica  2759 78.60% 0.70% 12.00% 8.70% NA
All Japonica  1512 95.00% 0.00% 1.72% 3.24% NA
Aus  269 52.40% 0.00% 8.55% 39.03% NA
Indica I  595 84.70% 0.50% 8.57% 6.22% NA
Indica II  465 90.80% 0.40% 4.52% 4.30% NA
Indica III  913 70.30% 1.20% 17.63% 10.84% NA
Indica Intermediate  786 76.50% 0.40% 12.47% 10.69% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 96.00% 0.00% 0.79% 3.17% NA
Japonica Intermediate  241 78.00% 0.00% 9.13% 12.86% NA
VI/Aromatic  96 74.00% 2.10% 10.42% 13.54% NA
Intermediate  90 86.70% 0.00% 3.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218731515 G -> DEL N N silent_mutation Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1218731515 G -> A LOC_Os12g31130.1 downstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1218731515 G -> A LOC_Os12g31120-LOC_Os12g31130 intergenic_region ; MODIFIER silent_mutation Average:20.236; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218731515 NA 4.07E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 8.33E-07 4.28E-08 mr1171 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 NA 1.65E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 NA 7.11E-06 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 NA 8.50E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 NA 4.01E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218731515 NA 4.96E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251