\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218724628:

Variant ID: vg1218724628 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18724628
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGCGGGCCTATGATGTAATAATTTATGCTAGACAATCTTTGTATGTGTACTTGGTATTTCAGCAATGTAACATGAGTGATTCCTGTTATAAAAATGGG[G/A]
GACGACAGTGCTATGCCACGATATTCATGGGATCCAAATTCTTTGCCATTTTCATACCAACATTGCACAAATCATTTGCCTTGACTGAAGTCTTGATGGA

Reverse complement sequence

TCCATCAAGACTTCAGTCAAGGCAAATGATTTGTGCAATGTTGGTATGAAAATGGCAAAGAATTTGGATCCCATGAATATCGTGGCATAGCACTGTCGTC[C/T]
CCCATTTTTATAACAGGAATCACTCATGTTACATTGCTGAAATACCAAGTACACATACAAAGATTGTCTAGCATAAATTATTACATCATAGGCCCGCAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 22.40% 0.23% 20.74% NA
All Indica  2759 72.90% 3.00% 0.33% 23.78% NA
All Japonica  1512 36.40% 57.90% 0.07% 5.56% NA
Aus  269 24.90% 2.60% 0.00% 72.49% NA
Indica I  595 80.00% 3.00% 0.34% 16.64% NA
Indica II  465 87.10% 0.90% 0.43% 11.61% NA
Indica III  913 65.40% 2.50% 0.22% 31.87% NA
Indica Intermediate  786 67.90% 4.70% 0.38% 26.97% NA
Temperate Japonica  767 61.40% 38.10% 0.00% 0.52% NA
Tropical Japonica  504 3.20% 92.50% 0.20% 4.17% NA
Japonica Intermediate  241 26.60% 49.00% 0.00% 24.48% NA
VI/Aromatic  96 5.20% 63.50% 0.00% 31.25% NA
Intermediate  90 46.70% 35.60% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218724628 G -> DEL N N silent_mutation Average:72.631; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg1218724628 G -> A LOC_Os12g31120-LOC_Os12g31130 intergenic_region ; MODIFIER silent_mutation Average:72.631; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218724628 G A 0.02 -0.02 -0.01 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218724628 3.13E-06 NA mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 3.85E-07 NA mr1091 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 9.82E-06 4.57E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 1.67E-06 8.53E-08 mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 6.78E-06 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 3.62E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 1.47E-06 NA mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 7.51E-07 NA mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 5.21E-06 NA mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 4.34E-06 NA mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 8.97E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 9.89E-09 4.06E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 2.90E-06 7.41E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 2.29E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 1.34E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 6.94E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 6.94E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 1.20E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 1.40E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 1.79E-06 4.38E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 4.24E-06 3.05E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724628 NA 2.48E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251