Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218724419:

Variant ID: vg1218724419 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18724419
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCACTCTTGCTGTTAAAAATTTTAATCAGTGGATGGCAATGAAGTCGAGGAGGATCCCTATGCTTATCTTTAGGAGGATGCAGAGGATGACGGCGCTC[T/C]
GTAGGTCTTAGTTACGGTCGTTGCCTGTGGCAATGACATGGCCGCTGCCTTATCTATTTCTGCTTTGGCATGTATTCCGGACCGTTCGGTCCTATGTTCT

Reverse complement sequence

AGAACATAGGACCGAACGGTCCGGAATACATGCCAAAGCAGAAATAGATAAGGCAGCGGCCATGTCATTGCCACAGGCAACGACCGTAACTAAGACCTAC[A/G]
GAGCGCCGTCATCCTCTGCATCCTCCTAAAGATAAGCATAGGGATCCTCCTCGACTTCATTGCCATCCACTGATTAAAATTTTTAACAGCAAGAGTGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 37.10% 0.49% 20.52% NA
All Indica  2759 68.60% 7.30% 0.51% 23.60% NA
All Japonica  1512 0.90% 93.50% 0.07% 5.56% NA
Aus  269 19.00% 7.80% 2.60% 70.63% NA
Indica I  595 74.10% 8.40% 0.50% 16.97% NA
Indica II  465 83.40% 5.20% 0.65% 10.75% NA
Indica III  913 64.70% 3.30% 0.33% 31.65% NA
Indica Intermediate  786 60.20% 12.30% 0.64% 26.84% NA
Temperate Japonica  767 1.20% 98.30% 0.00% 0.52% NA
Tropical Japonica  504 0.20% 95.40% 0.20% 4.17% NA
Japonica Intermediate  241 1.20% 74.30% 0.00% 24.48% NA
VI/Aromatic  96 3.10% 64.60% 1.04% 31.25% NA
Intermediate  90 22.20% 61.10% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218724419 T -> C LOC_Os12g31120-LOC_Os12g31130 intergenic_region ; MODIFIER silent_mutation Average:73.875; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg1218724419 T -> DEL N N silent_mutation Average:73.875; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218724419 T C 0.02 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218724419 NA 5.52E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 4.87E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 7.66E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 3.17E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 1.49E-12 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 3.21E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 3.45E-13 3.14E-60 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 2.13E-12 3.84E-22 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 5.14E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 4.23E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 2.24E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 6.02E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 5.15E-06 1.07E-21 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 4.96E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 3.96E-12 4.20E-65 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 7.63E-10 2.92E-21 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 2.50E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218724419 NA 1.33E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251