\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218663003:

Variant ID: vg1218663003 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18663003
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTCACCTTCACTTTCAAGGACCTCCACGCATTCTTTAAGATGGATAAAATGGATATCAATCTCGTCGGCGCGTGGTGCCTGTAAGCATTCCATGTAC[T/A]
TCGTTATTATCCAATGTGTGCCAATATAAATGTTGGTTATTCTAACTTCCAAATTTCCTCATGTCACAATGGGTAGACGCTCAAAGAATGGGGGCCTCAA

Reverse complement sequence

TTGAGGCCCCCATTCTTTGAGCGTCTACCCATTGTGACATGAGGAAATTTGGAAGTTAGAATAACCAACATTTATATTGGCACACATTGGATAATAACGA[A/T]
GTACATGGAATGCTTACAGGCACCACGCGCCGACGAGATTGATATCCATTTTATCCATCTTAAAGAATGCGTGGAGGTCCTTGAAAGTGAAGGTGAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 4.10% 2.56% 8.55% NA
All Indica  2759 99.80% 0.00% 0.07% 0.11% NA
All Japonica  1512 53.80% 12.60% 7.28% 26.39% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.34% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.13% 0.13% NA
Temperate Japonica  767 65.70% 1.80% 4.04% 28.42% NA
Tropical Japonica  504 42.10% 32.30% 8.73% 16.87% NA
Japonica Intermediate  241 40.20% 5.40% 14.52% 39.83% NA
VI/Aromatic  96 91.70% 2.10% 5.21% 1.04% NA
Intermediate  90 95.60% 0.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218663003 T -> DEL N N silent_mutation Average:16.256; most accessible tissue: Callus, score: 35.85 N N N N
vg1218663003 T -> A LOC_Os12g31040.1 downstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:16.256; most accessible tissue: Callus, score: 35.85 N N N N
vg1218663003 T -> A LOC_Os12g31060.1 downstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:16.256; most accessible tissue: Callus, score: 35.85 N N N N
vg1218663003 T -> A LOC_Os12g31050.1 intron_variant ; MODIFIER silent_mutation Average:16.256; most accessible tissue: Callus, score: 35.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218663003 8.57E-10 5.19E-15 mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.80E-09 5.74E-14 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.92E-08 3.47E-12 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 9.31E-09 2.98E-13 mr1019 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.27E-06 NA mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.08E-10 9.09E-16 mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 1.56E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 3.20E-06 3.20E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 2.47E-09 5.51E-14 mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 6.40E-06 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 2.46E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 1.22E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.94E-07 9.72E-12 mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 4.40E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 4.75E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 7.78E-06 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 4.76E-07 1.54E-11 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 2.30E-06 NA mr1491 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 4.74E-06 NA mr1778 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 2.79E-07 5.71E-11 mr1019_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 6.10E-08 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 3.02E-12 4.80E-15 mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 7.06E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.16E-13 1.98E-16 mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.28E-08 3.15E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 5.71E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 5.44E-07 5.60E-10 mr1261_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.98E-11 1.12E-14 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 NA 4.90E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.41E-07 NA mr1489_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 3.27E-12 3.65E-15 mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218663003 1.54E-06 NA mr1778_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251