\
| Variant ID: vg1218628528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18628528 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TAGACATGTCTTCTCGATTTGGCCATACTAGGAGTATTCATCATCCAAAATTGTTCCTAATCCCTACCATGCCTAATAATATGTTGTATGGGATGGTTTC[C/G]
TAGAGTGCAACATAGAAAACCTTAAGGAAGGGATGCCAAAACTTAGTCATGTTCTCGATCTTTTGTTGCTCATTTGAACACACGGATTTCCTATACGAAT
ATTCGTATAGGAAATCCGTGTGTTCAAATGAGCAACAAAAGATCGAGAACATGACTAAGTTTTGGCATCCCTTCCTTAAGGTTTTCTATGTTGCACTCTA[G/C]
GAAACCATCCCATACAACATATTATTAGGCATGGTAGGGATTAGGAACAATTTTGGATGATGAATACTCCTAGTATGGCCAAATCGAGAAGACATGTCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 35.60% | 2.09% | 1.63% | NA |
| All Indica | 2759 | 34.40% | 59.50% | 3.37% | 2.75% | NA |
| All Japonica | 1512 | 98.70% | 0.90% | 0.33% | 0.07% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 55.30% | 38.80% | 5.88% | 0.00% | NA |
| Indica II | 465 | 12.30% | 69.50% | 5.38% | 12.90% | NA |
| Indica III | 913 | 31.80% | 67.10% | 0.66% | 0.44% | NA |
| Indica Intermediate | 786 | 34.60% | 60.40% | 3.44% | 1.53% | NA |
| Temperate Japonica | 767 | 98.70% | 1.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218628528 | C -> DEL | N | N | silent_mutation | Average:36.801; most accessible tissue: Callus, score: 68.823 | N | N | N | N |
| vg1218628528 | C -> G | LOC_Os12g31020.1 | downstream_gene_variant ; 3055.0bp to feature; MODIFIER | silent_mutation | Average:36.801; most accessible tissue: Callus, score: 68.823 | N | N | N | N |
| vg1218628528 | C -> G | LOC_Os12g31000-LOC_Os12g31020 | intergenic_region ; MODIFIER | silent_mutation | Average:36.801; most accessible tissue: Callus, score: 68.823 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218628528 | NA | 8.98E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | NA | 1.66E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 6.50E-09 | 9.45E-20 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 3.83E-07 | 3.06E-11 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 7.68E-15 | 9.52E-58 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 6.64E-11 | 5.48E-18 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | NA | 4.34E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | NA | 4.17E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 1.88E-08 | 5.17E-27 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 1.91E-06 | 1.22E-11 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 8.11E-15 | 2.42E-60 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | 3.22E-12 | 2.42E-20 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218628528 | NA | 4.66E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |