Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218595627:

Variant ID: vg1218595627 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18595627
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TCTATCAACCTAGGATGAGAAAATATGGTTTTAAATTTTATTTTTTATATTTGCTTGACACATATGGATTCCACTGACTCGTAGACGCCACCGTGGCAAT[G/A]
CCGTGCCAACGCATGAGCGGGTTAGAATATCTTTGGACCTATATAACACCCATAACAAATTTAGGTACTACAAATACATTATAAGAGTTCAGGACCGCAC

Reverse complement sequence

GTGCGGTCCTGAACTCTTATAATGTATTTGTAGTACCTAAATTTGTTATGGGTGTTATATAGGTCCAAAGATATTCTAACCCGCTCATGCGTTGGCACGG[C/T]
ATTGCCACGGTGGCGTCTACGAGTCAGTGGAATCCATATGTGTCAAGCAAATATAAAAAATAAAATTTAAAACCATATTTTCTCATCCTAGGTTGATAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	11.50%	8.29%	12.89%	NA
All Indica	2759	44.90%	19.40%	13.92%	21.75%	NA
All Japonica	1512	99.50%	0.30%	0.07%	0.20%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	64.20%	9.60%	18.66%	7.56%	NA
Indica II	465	33.10%	20.40%	16.13%	30.32%	NA
Indica III	913	40.60%	25.10%	7.45%	26.83%	NA
Indica Intermediate	786	42.20%	19.70%	16.54%	21.50%	NA
Temperate Japonica	767	99.20%	0.40%	0.00%	0.39%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	3.30%	6.67%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218595627	G -> DEL	N	N	silent_mutation	Average:47.365; most accessible tissue: Callus, score: 58.069	N	N	N	N
vg1218595627	G -> A	LOC_Os12g30960.1	upstream_gene_variant ; 2277.0bp to feature; MODIFIER	silent_mutation	Average:47.365; most accessible tissue: Callus, score: 58.069	N	N	N	N
vg1218595627	G -> A	LOC_Os12g30960-LOC_Os12g30980	intergenic_region ; MODIFIER	silent_mutation	Average:47.365; most accessible tissue: Callus, score: 58.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218595627	NA	1.30E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	3.51E-10	2.14E-20	mr1457	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	3.32E-08	1.62E-11	mr1457	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	7.68E-16	1.22E-52	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	2.70E-12	6.02E-17	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	NA	1.42E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	5.27E-10	2.40E-27	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	3.81E-08	2.29E-12	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	2.40E-15	7.09E-56	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218595627	1.57E-13	7.74E-20	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251