\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218593113:

Variant ID: vg1218593113 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18593113
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAAGATATCCACAAACATGCAAGTCAAAATTCAACTTCAATAAATAGGAAAACAGTAAAATAAATTAACTATGAGTAGTGCGTACTACTTACAATTA[A/T]
ATTTGTATTTTTTCAACACATGCAAGTCGAATTTAAACTTACATATTTAGGAAGTAATATATCGCATATTAATCTTGTCGATTTTTGAAGTGTACAAGCG

Reverse complement sequence

CGCTTGTACACTTCAAAAATCGACAAGATTAATATGCGATATATTACTTCCTAAATATGTAAGTTTAAATTCGACTTGCATGTGTTGAAAAAATACAAAT[T/A]
TAATTGTAAGTAGTACGCACTACTCATAGTTAATTTATTTTACTGTTTTCCTATTTATTGAAGTTGAATTTTGACTTGCATGTTTGTGGATATCTTTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 32.90% 2.03% 0.80% NA
All Indica  2759 41.00% 55.40% 2.61% 0.98% NA
All Japonica  1512 97.50% 0.50% 1.39% 0.60% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 59.80% 35.80% 3.70% 0.67% NA
Indica II  465 31.20% 67.10% 1.51% 0.22% NA
Indica III  913 35.20% 59.90% 3.18% 1.75% NA
Indica Intermediate  786 39.40% 58.00% 1.78% 0.76% NA
Temperate Japonica  767 97.10% 0.70% 1.30% 0.91% NA
Tropical Japonica  504 98.60% 0.20% 0.99% 0.20% NA
Japonica Intermediate  241 96.30% 0.80% 2.49% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 78.90% 17.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218593113 A -> DEL N N silent_mutation Average:20.925; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N
vg1218593113 A -> T LOC_Os12g30960.1 intron_variant ; MODIFIER silent_mutation Average:20.925; most accessible tissue: Zhenshan97 young leaf, score: 37.172 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218593113 NA 1.73E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 NA 1.20E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 1.65E-09 6.83E-20 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 1.92E-07 4.76E-11 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 2.89E-13 8.09E-52 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 5.51E-10 4.41E-16 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 NA 6.06E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 1.03E-11 1.71E-29 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 2.41E-09 1.30E-13 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 4.33E-18 5.05E-59 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 1.35E-15 3.38E-21 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218593113 NA 4.21E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251