Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218590388:

Variant ID: vg1218590388 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18590388
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGATAAAAACAATTTCTCTACTTCCGACCCCACCCCACATCTCAACAATATTTATAACACTATGTTGATGAAAAATCCGCGCTCAGCCGATGGTGCCT[A/G]
GTCTGTGTTGGCGCGAACTAAGTCGACAAACACAACGGCCAGAGAGATCTGCTTAGTTCTAGTGCAGGTCCAAAGGTTGATGAGATGTAGGCGTGCCAGT

Reverse complement sequence

ACTGGCACGCCTACATCTCATCAACCTTTGGACCTGCACTAGAACTAAGCAGATCTCTCTGGCCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGAC[T/C]
AGGCACCATCGGCTGAGCGCGGATTTTTCATCAACATAGTGTTATAAATATTGTTGAGATGTGGGGTGGGGTCGGAAGTAGAGAAATTGTTTTTATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	29.80%	0.17%	0.00%	NA
All Indica	2759	61.40%	38.40%	0.18%	0.00%	NA
All Japonica	1512	97.90%	2.00%	0.07%	0.00%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	43.70%	56.00%	0.34%	0.00%	NA
Indica II	465	71.00%	29.00%	0.00%	0.00%	NA
Indica III	913	63.40%	36.50%	0.11%	0.00%	NA
Indica Intermediate	786	66.90%	32.80%	0.25%	0.00%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	35.40%	1.04%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218590388	A -> G	LOC_Os12g30950.1	upstream_gene_variant ; 2434.0bp to feature; MODIFIER	silent_mutation	Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1218590388	A -> G	LOC_Os12g30960.1	downstream_gene_variant ; 2085.0bp to feature; MODIFIER	silent_mutation	Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1218590388	A -> G	LOC_Os12g30950-LOC_Os12g30960	intergenic_region ; MODIFIER	silent_mutation	Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218590388	7.57E-06	NA	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	3.78E-06	9.50E-09	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	NA	7.61E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	NA	6.40E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	2.78E-07	NA	mr1457_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	6.46E-06	1.01E-08	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	9.74E-08	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388	6.57E-06	1.23E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251