\
| Variant ID: vg1218590388 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18590388 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )
TTCGATAAAAACAATTTCTCTACTTCCGACCCCACCCCACATCTCAACAATATTTATAACACTATGTTGATGAAAAATCCGCGCTCAGCCGATGGTGCCT[A/G]
GTCTGTGTTGGCGCGAACTAAGTCGACAAACACAACGGCCAGAGAGATCTGCTTAGTTCTAGTGCAGGTCCAAAGGTTGATGAGATGTAGGCGTGCCAGT
ACTGGCACGCCTACATCTCATCAACCTTTGGACCTGCACTAGAACTAAGCAGATCTCTCTGGCCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGAC[T/C]
AGGCACCATCGGCTGAGCGCGGATTTTTCATCAACATAGTGTTATAAATATTGTTGAGATGTGGGGTGGGGTCGGAAGTAGAGAAATTGTTTTTATCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 29.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 61.40% | 38.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.70% | 56.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.40% | 36.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.90% | 32.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 63.50% | 35.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218590388 | A -> G | LOC_Os12g30950.1 | upstream_gene_variant ; 2434.0bp to feature; MODIFIER | silent_mutation | Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg1218590388 | A -> G | LOC_Os12g30960.1 | downstream_gene_variant ; 2085.0bp to feature; MODIFIER | silent_mutation | Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg1218590388 | A -> G | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218590388 | 7.57E-06 | NA | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | 3.78E-06 | 9.50E-09 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | NA | 7.61E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | NA | 6.40E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | 2.78E-07 | NA | mr1457_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | 6.46E-06 | 1.01E-08 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | 9.74E-08 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590388 | 6.57E-06 | 1.23E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |