\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218590388:

Variant ID: vg1218590388 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18590388
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGATAAAAACAATTTCTCTACTTCCGACCCCACCCCACATCTCAACAATATTTATAACACTATGTTGATGAAAAATCCGCGCTCAGCCGATGGTGCCT[A/G]
GTCTGTGTTGGCGCGAACTAAGTCGACAAACACAACGGCCAGAGAGATCTGCTTAGTTCTAGTGCAGGTCCAAAGGTTGATGAGATGTAGGCGTGCCAGT

Reverse complement sequence

ACTGGCACGCCTACATCTCATCAACCTTTGGACCTGCACTAGAACTAAGCAGATCTCTCTGGCCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGAC[T/C]
AGGCACCATCGGCTGAGCGCGGATTTTTCATCAACATAGTGTTATAAATATTGTTGAGATGTGGGGTGGGGTCGGAAGTAGAGAAATTGTTTTTATCGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.80% 0.17% 0.00% NA
All Indica  2759 61.40% 38.40% 0.18% 0.00% NA
All Japonica  1512 97.90% 2.00% 0.07% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 43.70% 56.00% 0.34% 0.00% NA
Indica II  465 71.00% 29.00% 0.00% 0.00% NA
Indica III  913 63.40% 36.50% 0.11% 0.00% NA
Indica Intermediate  786 66.90% 32.80% 0.25% 0.00% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 35.40% 1.04% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218590388 A -> G LOC_Os12g30950.1 upstream_gene_variant ; 2434.0bp to feature; MODIFIER silent_mutation Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1218590388 A -> G LOC_Os12g30960.1 downstream_gene_variant ; 2085.0bp to feature; MODIFIER silent_mutation Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1218590388 A -> G LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:39.896; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218590388 7.57E-06 NA mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 3.78E-06 9.50E-09 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 NA 7.61E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 NA 6.40E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 2.78E-07 NA mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 6.46E-06 1.01E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 9.74E-08 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590388 6.57E-06 1.23E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251