\
| Variant ID: vg1218590374 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18590374 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 63. )
AGTAAACGATTTACTTCGATAAAAACAATTTCTCTACTTCCGACCCCACCCCACATCTCAACAATATTTATAACACTATGTTGATGAAAAATCCGCGCTC[A/C,T]
GCCGATGGTGCCTAGTCTGTGTTGGCGCGAACTAAGTCGACAAACACAACGGCCAGAGAGATCTGCTTAGTTCTAGTGCAGGTCCAAAGGTTGATGAGAT
ATCTCATCAACCTTTGGACCTGCACTAGAACTAAGCAGATCTCTCTGGCCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGACTAGGCACCATCGGC[T/G,A]
GAGCGCGGATTTTTCATCAACATAGTGTTATAAATATTGTTGAGATGTGGGGTGGGGTCGGAAGTAGAGAAATTGTTTTTATCGAAGTAAATCGTTTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.80% | 0.15% | 0.00% | T: 0.04% |
| All Indica | 2759 | 44.60% | 55.10% | 0.25% | 0.00% | T: 0.07% |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.40% | 35.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 40.10% | 59.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 41.60% | 57.80% | 0.38% | 0.00% | T: 0.25% |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218590374 | A -> C | LOC_Os12g30950.1 | upstream_gene_variant ; 2420.0bp to feature; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1218590374 | A -> C | LOC_Os12g30960.1 | downstream_gene_variant ; 2099.0bp to feature; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1218590374 | A -> C | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1218590374 | A -> T | LOC_Os12g30950.1 | upstream_gene_variant ; 2420.0bp to feature; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1218590374 | A -> T | LOC_Os12g30960.1 | downstream_gene_variant ; 2099.0bp to feature; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1218590374 | A -> T | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218590374 | NA | 1.15E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 4.52E-10 | 9.94E-21 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 6.40E-08 | 9.29E-12 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 2.55E-14 | 3.11E-54 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 8.82E-11 | 3.54E-17 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | NA | 4.94E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 1.08E-11 | 3.04E-30 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 2.71E-09 | 4.12E-14 | mr1457_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 1.70E-18 | 4.04E-61 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | 5.83E-16 | 3.29E-22 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218590374 | NA | 3.56E-07 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |