\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218589977:

Variant ID: vg1218589977 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18589977
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTCTCTCTAGGTGCCCATTCAGAACCCGGCACCAACGTGTATGAGCACTAGTGCCGACTAATATGTGCAGTATAGCCAGTTCCCAACCGGCTCTTAC[G/A]
ATGGTTTCTGTACTAGTGTTGGTGTATGCCTAAGTGACATGAATTAATATCATTAACATGATACACAAGTAGTTGTAATATGGTCTTAGTTTTCGATAAA

Reverse complement sequence

TTTATCGAAAACTAAGACCATATTACAACTACTTGTGTATCATGTTAATGATATTAATTCATGTCACTTAGGCATACACCAACACTAGTACAGAAACCAT[C/T]
GTAAGAGCCGGTTGGGAACTGGCTATACTGCACATATTAGTCGGCACTAGTGCTCATACACGTTGGTGCCGGGTTCTGAATGGGCACCTAGAGAGAATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.30% 0.19% 0.00% NA
All Indica  2759 44.30% 55.50% 0.22% 0.00% NA
All Japonica  1512 98.80% 1.10% 0.13% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 64.00% 35.80% 0.17% 0.00% NA
Indica II  465 32.90% 66.90% 0.22% 0.00% NA
Indica III  913 39.60% 60.10% 0.22% 0.00% NA
Indica Intermediate  786 41.30% 58.40% 0.25% 0.00% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218589977 G -> A LOC_Os12g30950.1 upstream_gene_variant ; 2023.0bp to feature; MODIFIER silent_mutation Average:44.975; most accessible tissue: Callus, score: 77.388 N N N N
vg1218589977 G -> A LOC_Os12g30960.1 downstream_gene_variant ; 2496.0bp to feature; MODIFIER silent_mutation Average:44.975; most accessible tissue: Callus, score: 77.388 N N N N
vg1218589977 G -> A LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:44.975; most accessible tissue: Callus, score: 77.388 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218589977 NA 1.82E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 8.57E-10 3.20E-20 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 1.59E-07 2.75E-11 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 2.92E-13 5.51E-51 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 4.06E-10 4.38E-16 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 NA 4.02E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 4.13E-11 5.83E-29 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 2.15E-09 6.93E-14 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 6.78E-17 4.32E-57 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977 7.18E-16 2.72E-21 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251