\
| Variant ID: vg1218589977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18589977 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )
ACATTCTCTCTAGGTGCCCATTCAGAACCCGGCACCAACGTGTATGAGCACTAGTGCCGACTAATATGTGCAGTATAGCCAGTTCCCAACCGGCTCTTAC[G/A]
ATGGTTTCTGTACTAGTGTTGGTGTATGCCTAAGTGACATGAATTAATATCATTAACATGATACACAAGTAGTTGTAATATGGTCTTAGTTTTCGATAAA
TTTATCGAAAACTAAGACCATATTACAACTACTTGTGTATCATGTTAATGATATTAATTCATGTCACTTAGGCATACACCAACACTAGTACAGAAACCAT[C/T]
GTAAGAGCCGGTTGGGAACTGGCTATACTGCACATATTAGTCGGCACTAGTGCTCATACACGTTGGTGCCGGGTTCTGAATGGGCACCTAGAGAGAATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.30% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 44.30% | 55.50% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.00% | 35.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 32.90% | 66.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 39.60% | 60.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 41.30% | 58.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218589977 | G -> A | LOC_Os12g30950.1 | upstream_gene_variant ; 2023.0bp to feature; MODIFIER | silent_mutation | Average:44.975; most accessible tissue: Callus, score: 77.388 | N | N | N | N |
| vg1218589977 | G -> A | LOC_Os12g30960.1 | downstream_gene_variant ; 2496.0bp to feature; MODIFIER | silent_mutation | Average:44.975; most accessible tissue: Callus, score: 77.388 | N | N | N | N |
| vg1218589977 | G -> A | LOC_Os12g30950-LOC_Os12g30960 | intergenic_region ; MODIFIER | silent_mutation | Average:44.975; most accessible tissue: Callus, score: 77.388 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218589977 | NA | 1.82E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 8.57E-10 | 3.20E-20 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 1.59E-07 | 2.75E-11 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 2.92E-13 | 5.51E-51 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 4.06E-10 | 4.38E-16 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | NA | 4.02E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 4.13E-11 | 5.83E-29 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 2.15E-09 | 6.93E-14 | mr1457_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 6.78E-17 | 4.32E-57 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218589977 | 7.18E-16 | 2.72E-21 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |