\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218588565:

Variant ID: vg1218588565 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18588565
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TAGACTTAATCCAAGGAGTAGCACGGTGGACTTTTGTGCCTTCGGGTCGGCCCAGGCTGTGCCTACGTCGTTGGTGTAGTCCGTGGACGGGCATGGCCCA[G/A]
TCCGGCGTGTAGGTCAGGTCATGCCAGCTCAACTGATCTCCGGACTGGGCGGCACATTTGGCCATCTATAATTTGGAGGGGGAGAAGTCTCACTAAATAT

Reverse complement sequence

ATATTTAGTGAGACTTCTCCCCCTCCAAATTATAGATGGCCAAATGTGCCGCCCAGTCCGGAGATCAGTTGAGCTGGCATGACCTGACCTACACGCCGGA[C/T]
TGGGCCATGCCCGTCCACGGACTACACCAACGACGTAGGCACAGCCTGGGCCGACCCGAAGGCACAAAAGTCCACCGTGCTACTCCTTGGATTAAGTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 33.00% 0.02% 0.00% NA
All Indica  2759 44.50% 55.50% 0.04% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 63.90% 36.10% 0.00% 0.00% NA
Indica II  465 33.30% 66.70% 0.00% 0.00% NA
Indica III  913 40.00% 60.00% 0.00% 0.00% NA
Indica Intermediate  786 41.70% 58.10% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218588565 G -> A LOC_Os12g30940.1 upstream_gene_variant ; 3639.0bp to feature; MODIFIER silent_mutation Average:68.053; most accessible tissue: Callus, score: 94.703 N N N N
vg1218588565 G -> A LOC_Os12g30950.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:68.053; most accessible tissue: Callus, score: 94.703 N N N N
vg1218588565 G -> A LOC_Os12g30960.1 downstream_gene_variant ; 3908.0bp to feature; MODIFIER silent_mutation Average:68.053; most accessible tissue: Callus, score: 94.703 N N N N
vg1218588565 G -> A LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:68.053; most accessible tissue: Callus, score: 94.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218588565 NA 7.59E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 NA 1.04E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 1.06E-09 2.55E-20 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 1.45E-07 2.22E-11 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 7.83E-15 4.75E-55 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 3.58E-11 1.62E-17 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 NA 7.61E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 NA 3.70E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 1.74E-11 4.96E-30 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 4.26E-09 6.52E-14 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 6.80E-19 9.11E-62 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 2.83E-16 1.73E-22 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218588565 NA 6.82E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251