\
| Variant ID: vg1218586541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18586541 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTGGTGTGCCTTCTATTGCCCTTGAGATAATACTCCCATCCTTGAGGGAGCATGGCAAGTGCCGGTACACTATATTATTAAGTCCCTGATCAAACATTTC[T/C]
CGATAGATGTTTGTTAAGACGCAATTGCCGTAAGCAAAGTATGGCCGTCCGATCTTCTGGGTAGGCTGAAGCCCTTGTATAGTGCGCCATTTGCTCCATT
AATGGAGCAAATGGCGCACTATACAAGGGCTTCAGCCTACCCAGAAGATCGGACGGCCATACTTTGCTTACGGCAATTGCGTCTTAACAAACATCTATCG[A/G]
GAAATGTTTGATCAGGGACTTAATAATATAGTGTACCGGCACTTGCCATGCTCCCTCAAGGATGGGAGTATTATCTCAAGGGCAATAGAAGGCACACCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.50% | 12.70% | 0.32% | 5.44% | NA |
| All Indica | 2759 | 77.50% | 15.90% | 0.36% | 6.31% | NA |
| All Japonica | 1512 | 98.30% | 0.70% | 0.13% | 0.86% | NA |
| Aus | 269 | 25.30% | 53.20% | 0.37% | 21.19% | NA |
| Indica I | 595 | 74.10% | 24.20% | 0.00% | 1.68% | NA |
| Indica II | 465 | 92.50% | 7.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 68.60% | 18.30% | 0.77% | 12.38% | NA |
| Indica Intermediate | 786 | 81.40% | 11.80% | 0.38% | 6.36% | NA |
| Temperate Japonica | 767 | 99.10% | 0.30% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.90% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 81.20% | 8.30% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218586541 | T -> C | LOC_Os12g30950.1 | synonymous_variant ; p.Arg356Arg; LOW | synonymous_codon | Average:47.082; most accessible tissue: Callus, score: 85.403 | N | N | N | N |
| vg1218586541 | T -> DEL | LOC_Os12g30950.1 | N | frameshift_variant | Average:47.082; most accessible tissue: Callus, score: 85.403 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218586541 | NA | 2.18E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 5.57E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 5.34E-06 | 5.36E-06 | mr1313 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 1.88E-06 | 1.88E-06 | mr1313 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 1.18E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 8.33E-07 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 5.26E-10 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 8.28E-06 | NA | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 5.91E-07 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 1.33E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 2.52E-07 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | 1.85E-06 | 8.00E-12 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218586541 | NA | 3.54E-06 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |