\
| Variant ID: vg1218585338 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18585338 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCCTCGGTATGATAGGCTGTCTCAGCACGTTCTGTTCAACGATCAGGGAAGCGAAGTAGTTGAGGAAGCTAAGATAGACAATTTCAGCCATATAAAACA[C/T]
GGCCCAAAGAGTTGATGGATGCAAAATTGACTTATTCCAGCGAGGCAAAATAGTTGAGGCCCGTGAAAATCACTTATTCTGTTGCTCTGCCGCTTGAAAA
TTTTCAAGCGGCAGAGCAACAGAATAAGTGATTTTCACGGGCCTCAACTATTTTGCCTCGCTGGAATAAGTCAATTTTGCATCCATCAACTCTTTGGGCC[G/A]
TGTTTTATATGGCTGAAATTGTCTATCTTAGCTTCCTCAACTACTTCGCTTCCCTGATCGTTGAACAGAACGTGCTGAGACAGCCTATCATACCGAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 33.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 44.50% | 55.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 32.70% | 67.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 39.40% | 60.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 42.10% | 57.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218585338 | C -> T | LOC_Os12g30940.1 | upstream_gene_variant ; 412.0bp to feature; MODIFIER | silent_mutation | Average:66.698; most accessible tissue: Callus, score: 97.738 | N | N | N | N |
| vg1218585338 | C -> T | LOC_Os12g30920.1 | downstream_gene_variant ; 4837.0bp to feature; MODIFIER | silent_mutation | Average:66.698; most accessible tissue: Callus, score: 97.738 | N | N | N | N |
| vg1218585338 | C -> T | LOC_Os12g30930.1 | downstream_gene_variant ; 3296.0bp to feature; MODIFIER | silent_mutation | Average:66.698; most accessible tissue: Callus, score: 97.738 | N | N | N | N |
| vg1218585338 | C -> T | LOC_Os12g30950.1 | downstream_gene_variant ; 1026.0bp to feature; MODIFIER | silent_mutation | Average:66.698; most accessible tissue: Callus, score: 97.738 | N | N | N | N |
| vg1218585338 | C -> T | LOC_Os12g30940-LOC_Os12g30950 | intergenic_region ; MODIFIER | silent_mutation | Average:66.698; most accessible tissue: Callus, score: 97.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218585338 | NA | 1.21E-11 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218585338 | 4.32E-06 | NA | mr1495 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218585338 | 2.15E-06 | 4.39E-23 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218585338 | 6.89E-09 | 1.62E-48 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |