Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218539756:

Variant ID: vg1218539756 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18539756
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAATTTCGCGCTATTTGGAAAGCTGTTGTTTGGCAGAGATTTATTGTGGTAGATGAGCCTGGCTCTCGTTTACTTACTTTGCAATTTCTGTGCACTTT[A/G,C]
AAAGAAATAGAAGATGGAATTTCCTTTCGCTTTTTCCATAAAGAGTACACACTTACATGGAAAGGCTTAAGTACACTTCTTGGCTTTCACGATTCCTGTA

Reverse complement sequence

TACAGGAATCGTGAAAGCCAAGAAGTGTACTTAAGCCTTTCCATGTAAGTGTGTACTCTTTATGGAAAAAGCGAAAGGAAATTCCATCTTCTATTTCTTT[T/C,G]
AAAGTGCACAGAAATTGCAAAGTAAGTAAACGAGAGCCAGGCTCATCTACCACAATAAATCTCTGCCAAACAACAGCTTTCCAAATAGCGCGAAATTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.30%	14.30%	11.15%	49.17%	C: 0.08%
All Indica	2759	32.30%	4.10%	15.77%	47.73%	C: 0.14%
All Japonica	1512	2.40%	35.60%	2.65%	59.26%	NA
Aus	269	78.10%	0.40%	7.43%	14.13%	NA
Indica I	595	24.40%	7.60%	13.28%	54.79%	NA
Indica II	465	14.80%	4.90%	13.76%	66.24%	C: 0.22%
Indica III	913	46.30%	0.70%	16.98%	35.71%	C: 0.33%
Indica Intermediate	786	32.20%	5.00%	17.43%	45.42%	NA
Temperate Japonica	767	0.00%	60.90%	1.43%	37.68%	NA
Tropical Japonica	504	6.70%	3.60%	3.57%	86.11%	NA
Japonica Intermediate	241	1.20%	22.40%	4.56%	71.78%	NA
VI/Aromatic	96	47.90%	0.00%	14.58%	37.50%	NA
Intermediate	90	13.30%	25.60%	20.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218539756	A -> C	LOC_Os12g30850.1	downstream_gene_variant ; 1915.0bp to feature; MODIFIER	silent_mutation	Average:6.218; most accessible tissue: Callus, score: 15.297	N	N	N	N
vg1218539756	A -> C	LOC_Os12g30850-LOC_Os12g30880	intergenic_region ; MODIFIER	silent_mutation	Average:6.218; most accessible tissue: Callus, score: 15.297	N	N	N	N
vg1218539756	A -> DEL	N	N	silent_mutation	Average:6.218; most accessible tissue: Callus, score: 15.297	N	N	N	N
vg1218539756	A -> G	LOC_Os12g30850.1	downstream_gene_variant ; 1915.0bp to feature; MODIFIER	silent_mutation	Average:6.218; most accessible tissue: Callus, score: 15.297	N	N	N	N
vg1218539756	A -> G	LOC_Os12g30850-LOC_Os12g30880	intergenic_region ; MODIFIER	silent_mutation	Average:6.218; most accessible tissue: Callus, score: 15.297	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218539756	NA	8.88E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756	NA	1.71E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756	7.42E-06	NA	mr1274	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756	NA	2.19E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756	NA	2.32E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756	NA	5.56E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251