\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218539756:

Variant ID: vg1218539756 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18539756
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAATTTCGCGCTATTTGGAAAGCTGTTGTTTGGCAGAGATTTATTGTGGTAGATGAGCCTGGCTCTCGTTTACTTACTTTGCAATTTCTGTGCACTTT[A/G,C]
AAAGAAATAGAAGATGGAATTTCCTTTCGCTTTTTCCATAAAGAGTACACACTTACATGGAAAGGCTTAAGTACACTTCTTGGCTTTCACGATTCCTGTA

Reverse complement sequence

TACAGGAATCGTGAAAGCCAAGAAGTGTACTTAAGCCTTTCCATGTAAGTGTGTACTCTTTATGGAAAAAGCGAAAGGAAATTCCATCTTCTATTTCTTT[T/C,G]
AAAGTGCACAGAAATTGCAAAGTAAGTAAACGAGAGCCAGGCTCATCTACCACAATAAATCTCTGCCAAACAACAGCTTTCCAAATAGCGCGAAATTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 14.30% 11.15% 49.17% C: 0.08%
All Indica  2759 32.30% 4.10% 15.77% 47.73% C: 0.14%
All Japonica  1512 2.40% 35.60% 2.65% 59.26% NA
Aus  269 78.10% 0.40% 7.43% 14.13% NA
Indica I  595 24.40% 7.60% 13.28% 54.79% NA
Indica II  465 14.80% 4.90% 13.76% 66.24% C: 0.22%
Indica III  913 46.30% 0.70% 16.98% 35.71% C: 0.33%
Indica Intermediate  786 32.20% 5.00% 17.43% 45.42% NA
Temperate Japonica  767 0.00% 60.90% 1.43% 37.68% NA
Tropical Japonica  504 6.70% 3.60% 3.57% 86.11% NA
Japonica Intermediate  241 1.20% 22.40% 4.56% 71.78% NA
VI/Aromatic  96 47.90% 0.00% 14.58% 37.50% NA
Intermediate  90 13.30% 25.60% 20.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218539756 A -> C LOC_Os12g30850.1 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:6.218; most accessible tissue: Callus, score: 15.297 N N N N
vg1218539756 A -> C LOC_Os12g30850-LOC_Os12g30880 intergenic_region ; MODIFIER silent_mutation Average:6.218; most accessible tissue: Callus, score: 15.297 N N N N
vg1218539756 A -> DEL N N silent_mutation Average:6.218; most accessible tissue: Callus, score: 15.297 N N N N
vg1218539756 A -> G LOC_Os12g30850.1 downstream_gene_variant ; 1915.0bp to feature; MODIFIER silent_mutation Average:6.218; most accessible tissue: Callus, score: 15.297 N N N N
vg1218539756 A -> G LOC_Os12g30850-LOC_Os12g30880 intergenic_region ; MODIFIER silent_mutation Average:6.218; most accessible tissue: Callus, score: 15.297 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218539756 NA 8.88E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756 NA 1.71E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756 7.42E-06 NA mr1274 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756 NA 2.19E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756 NA 2.32E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218539756 NA 5.56E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251