| Variant ID: vg1218539756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18539756 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGAATTTCGCGCTATTTGGAAAGCTGTTGTTTGGCAGAGATTTATTGTGGTAGATGAGCCTGGCTCTCGTTTACTTACTTTGCAATTTCTGTGCACTTT[A/G,C]
AAAGAAATAGAAGATGGAATTTCCTTTCGCTTTTTCCATAAAGAGTACACACTTACATGGAAAGGCTTAAGTACACTTCTTGGCTTTCACGATTCCTGTA
TACAGGAATCGTGAAAGCCAAGAAGTGTACTTAAGCCTTTCCATGTAAGTGTGTACTCTTTATGGAAAAAGCGAAAGGAAATTCCATCTTCTATTTCTTT[T/C,G]
AAAGTGCACAGAAATTGCAAAGTAAGTAAACGAGAGCCAGGCTCATCTACCACAATAAATCTCTGCCAAACAACAGCTTTCCAAATAGCGCGAAATTCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.30% | 14.30% | 11.15% | 49.17% | C: 0.08% |
| All Indica | 2759 | 32.30% | 4.10% | 15.77% | 47.73% | C: 0.14% |
| All Japonica | 1512 | 2.40% | 35.60% | 2.65% | 59.26% | NA |
| Aus | 269 | 78.10% | 0.40% | 7.43% | 14.13% | NA |
| Indica I | 595 | 24.40% | 7.60% | 13.28% | 54.79% | NA |
| Indica II | 465 | 14.80% | 4.90% | 13.76% | 66.24% | C: 0.22% |
| Indica III | 913 | 46.30% | 0.70% | 16.98% | 35.71% | C: 0.33% |
| Indica Intermediate | 786 | 32.20% | 5.00% | 17.43% | 45.42% | NA |
| Temperate Japonica | 767 | 0.00% | 60.90% | 1.43% | 37.68% | NA |
| Tropical Japonica | 504 | 6.70% | 3.60% | 3.57% | 86.11% | NA |
| Japonica Intermediate | 241 | 1.20% | 22.40% | 4.56% | 71.78% | NA |
| VI/Aromatic | 96 | 47.90% | 0.00% | 14.58% | 37.50% | NA |
| Intermediate | 90 | 13.30% | 25.60% | 20.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218539756 | A -> C | LOC_Os12g30850.1 | downstream_gene_variant ; 1915.0bp to feature; MODIFIER | silent_mutation | Average:6.218; most accessible tissue: Callus, score: 15.297 | N | N | N | N |
| vg1218539756 | A -> C | LOC_Os12g30850-LOC_Os12g30880 | intergenic_region ; MODIFIER | silent_mutation | Average:6.218; most accessible tissue: Callus, score: 15.297 | N | N | N | N |
| vg1218539756 | A -> DEL | N | N | silent_mutation | Average:6.218; most accessible tissue: Callus, score: 15.297 | N | N | N | N |
| vg1218539756 | A -> G | LOC_Os12g30850.1 | downstream_gene_variant ; 1915.0bp to feature; MODIFIER | silent_mutation | Average:6.218; most accessible tissue: Callus, score: 15.297 | N | N | N | N |
| vg1218539756 | A -> G | LOC_Os12g30850-LOC_Os12g30880 | intergenic_region ; MODIFIER | silent_mutation | Average:6.218; most accessible tissue: Callus, score: 15.297 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218539756 | NA | 8.88E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218539756 | NA | 1.71E-11 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218539756 | 7.42E-06 | NA | mr1274 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218539756 | NA | 2.19E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218539756 | NA | 2.32E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218539756 | NA | 5.56E-06 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |