\
| Variant ID: vg1218529611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18529611 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAACACACCCTAAATCTCAACCCTCGTGGCGCATAGGCTAAAATTATGGAAAGTAACCTGTGCAATCAATCCTATTTATTCTTTTCTTCCGTAATTTTCT[A/G]
ATCTATGCAGATTAGGAGCAAAAGGGACAGTCCCTAATTTCAAATGTTGATTAGGATTATTCATGTGGCATATTAAGTTGGTCCAAAGATGATTTAAATA
TATTTAAATCATCTTTGGACCAACTTAATATGCCACATGAATAATCCTAATCAACATTTGAAATTAGGGACTGTCCCTTTTGCTCCTAATCTGCATAGAT[T/C]
AGAAAATTACGGAAGAAAAGAATAAATAGGATTGATTGCACAGGTTACTTTCCATAATTTTAGCCTATGCGCCACGAGGGTTGAGATTTAGGGTGTGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 29.60% | 0.78% | 7.79% | NA |
| All Indica | 2759 | 83.10% | 12.10% | 0.69% | 4.06% | NA |
| All Japonica | 1512 | 35.40% | 59.40% | 0.53% | 4.63% | NA |
| Aus | 269 | 15.20% | 16.00% | 2.60% | 66.17% | NA |
| Indica I | 595 | 89.10% | 5.50% | 0.17% | 5.21% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.22% | 0.22% | NA |
| Indica III | 913 | 75.80% | 18.90% | 1.53% | 3.72% | NA |
| Indica Intermediate | 786 | 78.80% | 15.00% | 0.38% | 5.85% | NA |
| Temperate Japonica | 767 | 59.10% | 39.60% | 0.91% | 0.39% | NA |
| Tropical Japonica | 504 | 4.60% | 91.70% | 0.00% | 3.77% | NA |
| Japonica Intermediate | 241 | 24.90% | 54.80% | 0.41% | 19.92% | NA |
| VI/Aromatic | 96 | 2.10% | 92.70% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 54.40% | 38.90% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218529611 | A -> DEL | N | N | silent_mutation | Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1218529611 | A -> G | LOC_Os12g30824.1 | upstream_gene_variant ; 911.0bp to feature; MODIFIER | silent_mutation | Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1218529611 | A -> G | LOC_Os12g30824.2 | upstream_gene_variant ; 911.0bp to feature; MODIFIER | silent_mutation | Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1218529611 | A -> G | LOC_Os12g30840.1 | downstream_gene_variant ; 1822.0bp to feature; MODIFIER | silent_mutation | Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1218529611 | A -> G | LOC_Os12g30824-LOC_Os12g30840 | intergenic_region ; MODIFIER | silent_mutation | Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218529611 | NA | 8.68E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | NA | 5.71E-08 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | 1.15E-06 | 8.58E-43 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | 6.33E-15 | 2.08E-28 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | NA | 3.05E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | NA | 7.32E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | NA | 1.59E-15 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | NA | 2.10E-08 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218529611 | 1.59E-20 | 7.40E-40 | mr1458_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |