\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218529611:

Variant ID: vg1218529611 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18529611
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACACACCCTAAATCTCAACCCTCGTGGCGCATAGGCTAAAATTATGGAAAGTAACCTGTGCAATCAATCCTATTTATTCTTTTCTTCCGTAATTTTCT[A/G]
ATCTATGCAGATTAGGAGCAAAAGGGACAGTCCCTAATTTCAAATGTTGATTAGGATTATTCATGTGGCATATTAAGTTGGTCCAAAGATGATTTAAATA

Reverse complement sequence

TATTTAAATCATCTTTGGACCAACTTAATATGCCACATGAATAATCCTAATCAACATTTGAAATTAGGGACTGTCCCTTTTGCTCCTAATCTGCATAGAT[T/C]
AGAAAATTACGGAAGAAAAGAATAAATAGGATTGATTGCACAGGTTACTTTCCATAATTTTAGCCTATGCGCCACGAGGGTTGAGATTTAGGGTGTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 29.60% 0.78% 7.79% NA
All Indica  2759 83.10% 12.10% 0.69% 4.06% NA
All Japonica  1512 35.40% 59.40% 0.53% 4.63% NA
Aus  269 15.20% 16.00% 2.60% 66.17% NA
Indica I  595 89.10% 5.50% 0.17% 5.21% NA
Indica II  465 97.20% 2.40% 0.22% 0.22% NA
Indica III  913 75.80% 18.90% 1.53% 3.72% NA
Indica Intermediate  786 78.80% 15.00% 0.38% 5.85% NA
Temperate Japonica  767 59.10% 39.60% 0.91% 0.39% NA
Tropical Japonica  504 4.60% 91.70% 0.00% 3.77% NA
Japonica Intermediate  241 24.90% 54.80% 0.41% 19.92% NA
VI/Aromatic  96 2.10% 92.70% 0.00% 5.21% NA
Intermediate  90 54.40% 38.90% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218529611 A -> DEL N N silent_mutation Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1218529611 A -> G LOC_Os12g30824.1 upstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1218529611 A -> G LOC_Os12g30824.2 upstream_gene_variant ; 911.0bp to feature; MODIFIER silent_mutation Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1218529611 A -> G LOC_Os12g30840.1 downstream_gene_variant ; 1822.0bp to feature; MODIFIER silent_mutation Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1218529611 A -> G LOC_Os12g30824-LOC_Os12g30840 intergenic_region ; MODIFIER silent_mutation Average:40.435; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218529611 NA 8.68E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 NA 5.71E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 1.15E-06 8.58E-43 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 6.33E-15 2.08E-28 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 NA 3.05E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 NA 7.32E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 NA 1.59E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 NA 2.10E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611 1.59E-20 7.40E-40 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251