Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218508238:

Variant ID: vg1218508238 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18508238
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTCGGTTCTCCTCCATTTGTGTTTATTCTCTGCAAGAGGTTAGTAATCCTAGTGCTAGTGGAATATATATTATTTTGACACAAATATGCATTGCAAG[T/C]
ATAACTAGTTCTCCTTTATTTAGGTAACATTGACGGGCGAAACTGATCACTAACGACCGTCAACACAAACCTCGATCCAACTCCATCAACCTTGATCTCT

Reverse complement sequence

AGAGATCAAGGTTGATGGAGTTGGATCGAGGTTTGTGTTGACGGTCGTTAGTGATCAGTTTCGCCCGTCAATGTTACCTAAATAAAGGAGAACTAGTTAT[A/G]
CTTGCAATGCATATTTGTGTCAAAATAATATATATTCCACTAGCACTAGGATTACTAACCTCTTGCAGAGAATAAACACAAATGGAGGAGAACCGACATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.70%	0.40%	3.98%	80.98%	NA
All Indica	2759	4.40%	0.40%	5.00%	90.18%	NA
All Japonica	1512	35.80%	0.30%	2.45%	61.38%	NA
Aus	269	0.70%	0.00%	1.86%	97.40%	NA
Indica I	595	5.20%	0.70%	7.06%	87.06%	NA
Indica II	465	4.90%	0.40%	2.58%	92.04%	NA
Indica III	913	3.80%	0.00%	4.49%	91.68%	NA
Indica Intermediate	786	4.10%	0.80%	5.47%	89.69%	NA
Temperate Japonica	767	60.00%	0.00%	1.43%	38.59%	NA
Tropical Japonica	504	5.00%	1.00%	3.77%	90.28%	NA
Japonica Intermediate	241	23.70%	0.00%	2.90%	73.44%	NA
VI/Aromatic	96	1.00%	0.00%	2.08%	96.88%	NA
Intermediate	90	30.00%	1.10%	6.67%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218508238	T -> C	LOC_Os12g30810.1	downstream_gene_variant ; 150.0bp to feature; MODIFIER	silent_mutation	Average:22.843; most accessible tissue: Callus, score: 43.704	N	N	N	N
vg1218508238	T -> C	LOC_Os12g30824.1	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:22.843; most accessible tissue: Callus, score: 43.704	N	N	N	N
vg1218508238	T -> C	LOC_Os12g30824.2	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:22.843; most accessible tissue: Callus, score: 43.704	N	N	N	N
vg1218508238	T -> C	LOC_Os12g30800-LOC_Os12g30810	intergenic_region ; MODIFIER	silent_mutation	Average:22.843; most accessible tissue: Callus, score: 43.704	N	N	N	N
vg1218508238	T -> DEL	N	N	silent_mutation	Average:22.843; most accessible tissue: Callus, score: 43.704	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218508238	NA	7.39E-06	mr1457_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218508238	7.86E-06	2.22E-08	mr1458_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218508238	NA	1.08E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218508238	NA	3.27E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251