| Variant ID: vg1218508170 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18508170 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGTTCTTGGCCCATCTTTCCATAAGTCTGATTCTCGACATCGCACGATTGATTGATCATCTATTTTGATGTCGGTTCTCCTCCATTTGTGTTTATTCT[C/T]
TGCAAGAGGTTAGTAATCCTAGTGCTAGTGGAATATATATTATTTTGACACAAATATGCATTGCAAGTATAACTAGTTCTCCTTTATTTAGGTAACATTG
CAATGTTACCTAAATAAAGGAGAACTAGTTATACTTGCAATGCATATTTGTGTCAAAATAATATATATTCCACTAGCACTAGGATTACTAACCTCTTGCA[G/A]
AGAATAAACACAAATGGAGGAGAACCGACATCAAAATAGATGATCAATCAATCGTGCGATGTCGAGAATCAGACTTATGGAAAGATGGGCCAAGAACTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.00% | 2.10% | 9.37% | 69.51% | NA |
| All Indica | 2759 | 8.80% | 1.40% | 8.92% | 80.83% | NA |
| All Japonica | 1512 | 40.30% | 3.00% | 8.27% | 48.41% | NA |
| Aus | 269 | 4.80% | 3.70% | 18.59% | 72.86% | NA |
| Indica I | 595 | 11.10% | 1.20% | 9.58% | 78.15% | NA |
| Indica II | 465 | 7.50% | 2.80% | 7.10% | 82.58% | NA |
| Indica III | 913 | 9.10% | 0.50% | 8.11% | 82.26% | NA |
| Indica Intermediate | 786 | 7.50% | 1.90% | 10.43% | 80.15% | NA |
| Temperate Japonica | 767 | 61.70% | 0.40% | 1.83% | 36.11% | NA |
| Tropical Japonica | 504 | 13.90% | 7.70% | 18.06% | 60.32% | NA |
| Japonica Intermediate | 241 | 27.40% | 1.70% | 8.30% | 62.66% | NA |
| VI/Aromatic | 96 | 5.20% | 0.00% | 13.54% | 81.25% | NA |
| Intermediate | 90 | 33.30% | 2.20% | 10.00% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218508170 | C -> DEL | N | N | silent_mutation | Average:18.582; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1218508170 | C -> T | LOC_Os12g30810.1 | downstream_gene_variant ; 218.0bp to feature; MODIFIER | silent_mutation | Average:18.582; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1218508170 | C -> T | LOC_Os12g30824.1 | downstream_gene_variant ; 1673.0bp to feature; MODIFIER | silent_mutation | Average:18.582; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1218508170 | C -> T | LOC_Os12g30824.2 | downstream_gene_variant ; 1673.0bp to feature; MODIFIER | silent_mutation | Average:18.582; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1218508170 | C -> T | LOC_Os12g30800-LOC_Os12g30810 | intergenic_region ; MODIFIER | silent_mutation | Average:18.582; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218508170 | 8.25E-06 | 8.25E-06 | mr1223_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218508170 | 8.71E-06 | 1.36E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218508170 | 3.76E-06 | 1.59E-07 | mr1248_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218508170 | 4.23E-06 | NA | mr1728_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218508170 | NA | 3.47E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |