\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218456968:

Variant ID: vg1218456968 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18456968
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTAGTTAAAAAAAAACTTTTCCAAAAATATCACATCGAATCTTTGAACATATAACATATATGGAGCATTAAATATAGATAAAAAGAAAAACTAATTG[T/C]
ACAATTTGCATGTAAATCGCAAGACGAATCTTTTGAGCCTAATTAGGCCATTATTAGCCATAGGTGCTACATAGTAACCCACATGTGCTAATGACGGATT

Reverse complement sequence

AATCCGTCATTAGCACATGTGGGTTACTATGTAGCACCTATGGCTAATAATGGCCTAATTAGGCTCAAAAGATTCGTCTTGCGATTTACATGCAAATTGT[A/G]
CAATTAGTTTTTCTTTTTATCTATATTTAATGCTCCATATATGTTATATGTTCAAAGATTCGATGTGATATTTTTGGAAAAGTTTTTTTTTAACTAAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 6.00% 1.59% 59.04% NA
All Indica  2759 35.30% 1.70% 1.12% 61.83% NA
All Japonica  1512 34.70% 5.40% 0.33% 59.59% NA
Aus  269 6.30% 54.30% 11.90% 27.51% NA
Indica I  595 58.00% 0.00% 1.18% 40.84% NA
Indica II  465 20.90% 0.20% 0.00% 78.92% NA
Indica III  913 28.50% 3.40% 1.10% 67.03% NA
Indica Intermediate  786 34.70% 1.90% 1.78% 61.58% NA
Temperate Japonica  767 59.10% 0.30% 0.39% 40.29% NA
Tropical Japonica  504 3.20% 4.00% 0.40% 92.46% NA
Japonica Intermediate  241 23.20% 24.50% 0.00% 52.28% NA
VI/Aromatic  96 16.70% 4.20% 5.21% 73.96% NA
Intermediate  90 51.10% 4.40% 2.22% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218456968 T -> C LOC_Os12g30740.1 upstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1218456968 T -> C LOC_Os12g30730.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1218456968 T -> C LOC_Os12g30720-LOC_Os12g30730 intergenic_region ; MODIFIER silent_mutation Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1218456968 T -> DEL N N silent_mutation Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218456968 7.56E-08 7.91E-20 mr1117 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 5.90E-07 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 1.67E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 4.41E-08 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 4.52E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 6.94E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 6.72E-09 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 4.52E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 5.11E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 9.44E-06 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 7.57E-06 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 4.57E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 2.97E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 8.82E-06 1.38E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968 NA 1.47E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251