Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218456968:

Variant ID: vg1218456968 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18456968
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTAGTTAAAAAAAAACTTTTCCAAAAATATCACATCGAATCTTTGAACATATAACATATATGGAGCATTAAATATAGATAAAAAGAAAAACTAATTG[T/C]
ACAATTTGCATGTAAATCGCAAGACGAATCTTTTGAGCCTAATTAGGCCATTATTAGCCATAGGTGCTACATAGTAACCCACATGTGCTAATGACGGATT

Reverse complement sequence

AATCCGTCATTAGCACATGTGGGTTACTATGTAGCACCTATGGCTAATAATGGCCTAATTAGGCTCAAAAGATTCGTCTTGCGATTTACATGCAAATTGT[A/G]
CAATTAGTTTTTCTTTTTATCTATATTTAATGCTCCATATATGTTATATGTTCAAAGATTCGATGTGATATTTTTGGAAAAGTTTTTTTTTAACTAAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	6.00%	1.59%	59.04%	NA
All Indica	2759	35.30%	1.70%	1.12%	61.83%	NA
All Japonica	1512	34.70%	5.40%	0.33%	59.59%	NA
Aus	269	6.30%	54.30%	11.90%	27.51%	NA
Indica I	595	58.00%	0.00%	1.18%	40.84%	NA
Indica II	465	20.90%	0.20%	0.00%	78.92%	NA
Indica III	913	28.50%	3.40%	1.10%	67.03%	NA
Indica Intermediate	786	34.70%	1.90%	1.78%	61.58%	NA
Temperate Japonica	767	59.10%	0.30%	0.39%	40.29%	NA
Tropical Japonica	504	3.20%	4.00%	0.40%	92.46%	NA
Japonica Intermediate	241	23.20%	24.50%	0.00%	52.28%	NA
VI/Aromatic	96	16.70%	4.20%	5.21%	73.96%	NA
Intermediate	90	51.10%	4.40%	2.22%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218456968	T -> C	LOC_Os12g30740.1	upstream_gene_variant ; 4381.0bp to feature; MODIFIER	silent_mutation	Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1218456968	T -> C	LOC_Os12g30730.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1218456968	T -> C	LOC_Os12g30720-LOC_Os12g30730	intergenic_region ; MODIFIER	silent_mutation	Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1218456968	T -> DEL	N	N	silent_mutation	Average:15.886; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218456968	7.56E-08	7.91E-20	mr1117	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	5.90E-07	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	1.67E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	4.41E-08	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	4.52E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	6.94E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	6.72E-09	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	4.52E-10	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	5.11E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	9.44E-06	NA	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	7.57E-06	NA	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	4.57E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	2.97E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	8.82E-06	1.38E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218456968	NA	1.47E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251