\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218455068:

Variant ID: vg1218455068 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18455068
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCTTGTAGCCACCGTGTTGTAATATGTTTACTGATGTGTTCAATACACAGTATAAGAGTAAAAACTGAAATTTCATGGTCTACGAGTAAAACAATTA[T/C]
CACCTTCCTCTCGATATAGCCATGATTTCATAGCCACCGTGTAGTAATATGTTTACTGATATGTTCAATACACAATATAAGAGTAAAAACTGATACTAAG

Reverse complement sequence

CTTAGTATCAGTTTTTACTCTTATATTGTGTATTGAACATATCAGTAAACATATTACTACACGGTGGCTATGAAATCATGGCTATATCGAGAGGAAGGTG[A/G]
TAATTGTTTTACTCGTAGACCATGAAATTTCAGTTTTTACTCTTATACTGTGTATTGAACACATCAGTAAACATATTACAACACGGTGGCTACAAGATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 5.90% 0.99% 60.05% NA
All Indica  2759 34.90% 1.70% 0.91% 62.49% NA
All Japonica  1512 34.70% 5.40% 0.93% 59.06% NA
Aus  269 4.80% 54.30% 1.49% 39.41% NA
Indica I  595 57.30% 0.00% 0.50% 42.18% NA
Indica II  465 20.20% 0.20% 1.08% 78.49% NA
Indica III  913 28.40% 3.30% 0.77% 67.58% NA
Indica Intermediate  786 34.40% 1.90% 1.27% 62.47% NA
Temperate Japonica  767 58.90% 0.30% 1.04% 39.77% NA
Tropical Japonica  504 3.40% 4.00% 0.60% 92.06% NA
Japonica Intermediate  241 22.80% 24.50% 1.24% 51.45% NA
VI/Aromatic  96 14.60% 4.20% 2.08% 79.17% NA
Intermediate  90 50.00% 4.40% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218455068 T -> C LOC_Os12g30730.1 downstream_gene_variant ; 3422.0bp to feature; MODIFIER silent_mutation Average:11.003; most accessible tissue: Callus, score: 39.621 N N N N
vg1218455068 T -> C LOC_Os12g30720-LOC_Os12g30730 intergenic_region ; MODIFIER silent_mutation Average:11.003; most accessible tissue: Callus, score: 39.621 N N N N
vg1218455068 T -> DEL N N silent_mutation Average:11.003; most accessible tissue: Callus, score: 39.621 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218455068 1.60E-07 9.75E-20 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 1.94E-07 NA mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 1.06E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 2.18E-08 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 1.81E-06 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 2.71E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 7.14E-10 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 9.66E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 2.58E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 4.41E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 3.85E-07 1.10E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 5.66E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 1.80E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 7.44E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 1.32E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 2.36E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 5.74E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 9.38E-07 1.48E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 NA 2.79E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218455068 5.49E-06 3.52E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251