\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218449910:

Variant ID: vg1218449910 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18449910
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAACGGTATCGGTACGGTCGGGAAATTTCCATACCGTTTACACCCCTAGTCTCAACATCGCTGAGCCTCTCTCTTAAACGCTCGGTGGCAGCTTCGAG[A/G]
GCGCGCACACGCTTGCGGGCTTTGAAGAAGTAGGCGGCGTACTGTTTCGAGAGGCGTATCAAGGAGATCAGGATAGCACCAGAGCACTTGATGCCGATGA

Reverse complement sequence

TCATCGGCATCAAGTGCTCTGGTGCTATCCTGATCTCCTTGATACGCCTCTCGAAACAGTACGCCGCCTACTTCTTCAAAGCCCGCAAGCGTGTGCGCGC[T/C]
CTCGAAGCTGCCACCGAGCGTTTAAGAGAGAGGCTCAGCGATGTTGAGACTAGGGGTGTAAACGGTATGGAAATTTCCCGACCGTACCGATACCGTTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 26.30% 0.15% 1.71% NA
All Indica  2759 54.20% 44.50% 0.22% 1.09% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 81.80% 0.00% 0.37% 17.84% NA
Indica I  595 90.60% 9.10% 0.17% 0.17% NA
Indica II  465 41.10% 58.50% 0.43% 0.00% NA
Indica III  913 38.30% 58.90% 0.33% 2.41% NA
Indica Intermediate  786 52.90% 46.20% 0.00% 0.89% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 87.80% 11.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218449910 A -> DEL LOC_Os12g30720.1 N frameshift_variant Average:65.575; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N
vg1218449910 A -> G LOC_Os12g30720.1 synonymous_variant ; p.Ala36Ala; LOW synonymous_codon Average:65.575; most accessible tissue: Minghui63 panicle, score: 85.069 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218449910 A G 0.03 0.02 0.02 0.03 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218449910 NA 5.25E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 8.22E-07 1.83E-15 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 1.12E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 3.63E-11 4.15E-46 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 4.02E-08 4.60E-16 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 4.24E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 3.07E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 9.71E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 9.68E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 6.18E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 2.01E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 2.88E-06 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 5.96E-12 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 1.62E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 2.32E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 1.20E-07 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 4.64E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218449910 NA 1.53E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251