\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218448864:

Variant ID: vg1218448864 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18448864
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGAAACAACAAATATTTCCGTCCGGAGGGAGTATTACATGATAGTAGTACCTGATGGCAGTCAATATGAAGACTGTTAGTATCCTAGAAATCGTTGCTC[C/T]
TATAAAACAAACTATAATTTTAGCTGGAGCTTTGAGGCTCCATGAATTGCTCATTAGGTCGCTTACCCTAGATGGTTTGTAATTTTTGTCTTTTGGGCAA

Reverse complement sequence

TTGCCCAAAAGACAAAAATTACAAACCATCTAGGGTAAGCGACCTAATGAGCAATTCATGGAGCCTCAAAGCTCCAGCTAAAATTATAGTTTGTTTTATA[G/A]
GAGCAACGATTTCTAGGATACTAACAGTCTTCATATTGACTGCCATCAGGTACTACTATCATGTAATACTCCCTCCGGACGGAAATATTTGTTGTTTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 9.30% 26.15% 15.38% NA
All Indica  2759 23.60% 11.70% 40.63% 24.03% NA
All Japonica  1512 98.40% 0.30% 1.12% 0.20% NA
Aus  269 12.60% 38.30% 30.11% 18.96% NA
Indica I  595 37.10% 11.90% 41.51% 9.41% NA
Indica II  465 15.70% 5.60% 47.96% 30.75% NA
Indica III  913 17.90% 13.50% 39.43% 29.24% NA
Indica Intermediate  786 24.80% 13.10% 37.02% 25.06% NA
Temperate Japonica  767 98.80% 0.10% 0.65% 0.39% NA
Tropical Japonica  504 99.00% 0.20% 0.79% 0.00% NA
Japonica Intermediate  241 95.90% 0.80% 3.32% 0.00% NA
VI/Aromatic  96 82.30% 8.30% 6.25% 3.12% NA
Intermediate  90 76.70% 3.30% 12.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218448864 C -> DEL N N silent_mutation Average:30.493; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg1218448864 C -> T LOC_Os12g30720.1 intron_variant ; MODIFIER silent_mutation Average:30.493; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218448864 NA 5.76E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 6.19E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 7.77E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 6.94E-09 NA mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 2.73E-07 2.12E-14 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 6.16E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 2.38E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 1.44E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 2.14E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 3.03E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 3.64E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 1.26E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 2.06E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 3.12E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 1.44E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 7.57E-06 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 2.83E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 6.74E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 3.20E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 3.62E-16 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218448864 NA 1.30E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251