Search for Variation information by Variation ID:
Detailed information for vg1218431169:
| Variant ID: vg1218431169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18431169 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )
Flanking Sequence (100 bp) in Reference Genome:
CAGGCTCGGGGTGCCGGCGGGCAAGACAAGATTGCTTACTCCCTCCACAAAGGGAATAAGGTCCGCCTGGGTCACGAAGTCACCAGGGACGAAGTGGGGC[G/A]
CCGCAAGGGAATACTCCGAGGCAGATGCTTCGGCGGCCACACACTTCCCCTTCGCCTTGACCAGCGGTGAAATAGCTGGCTCGCGCACAGGGCTCCCGAA
Reverse complement sequence
TTCGGGAGCCCTGTGCGCGAGCCAGCTATTTCACCGCTGGTCAAGGCGAAGGGGAAGTGTGTGGCCGCCGAAGCATCTGCCTCGGAGTATTCCCTTGCGG[C/T]
GCCCCACTTCGTCCCTGGTGACTTCGTGACCCAGGCGGACCTTATTCCCTTTGTGGAGGGAGTAAGCAATCTTGTCTTGCCCGCCGGCACCCCGAGCCTG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 11.90% | 19.04% | 15.53% | NA |
| All Indica | 2759 | 30.60% | 20.10% | 30.37% | 18.96% | NA |
| All Japonica | 1512 | 98.40% | 0.00% | 0.40% | 1.19% | NA |
| Aus | 269 | 17.50% | 0.00% | 13.01% | 69.52% | NA |
| Indica I | 595 | 44.90% | 9.70% | 28.40% | 16.97% | NA |
| Indica II | 465 | 34.80% | 8.40% | 31.83% | 24.95% | NA |
| Indica III | 913 | 18.40% | 36.00% | 30.45% | 15.12% | NA |
| Indica Intermediate | 786 | 31.30% | 16.40% | 30.92% | 21.37% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 1.24% | 4.15% | NA |
| VI/Aromatic | 96 | 84.40% | 1.00% | 12.50% | 2.08% | NA |
| Intermediate | 90 | 78.90% | 6.70% | 10.00% | 4.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218431169 | G -> DEL | LOC_Os12g30690.1 | N | frameshift_variant | Average:49.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| vg1218431169 | G -> A | LOC_Os12g30690.1 | missense_variant ; p.Ala499Val; MODERATE | nonsynonymous_codon ; A499V | Average:49.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | benign  |
0.588 |
TOLERATED | 0.24 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218431169 | NA | 2.06E-08 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218431169 | NA | 1.54E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218431169 | NA | 2.38E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218431169 | NA | 1.42E-06 | mr1403 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218431169 | NA | 7.07E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218431169 | NA | 2.88E-06 | mr1552 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |