\
| Variant ID: vg1218417268 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18417268 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTGGCCAAGCGCCACAAACAGTGGCGGAAGGGGCTTCGGCTCTGCAGGCGCAACTCCAAGCTTTCCTTCAGCAACTCAACCAACCTCACTGCATTTCAA[G/A]
TACAACCCCATCGGCCCACCCGGAGGGGAATACAAGTCAAGGTGTGCCTAATTGGTTGCCACCGATTCAGCCGGGCCTAGGAGTTTTTGTAACGCCCCGA
TCGGGGCGTTACAAAAACTCCTAGGCCCGGCTGAATCGGTGGCAACCAATTAGGCACACCTTGACTTGTATTCCCCTCCGGGTGGGCCGATGGGGTTGTA[C/T]
TTGAAATGCAGTGAGGTTGGTTGAGTTGCTGAAGGAAAGCTTGGAGTTGCGCCTGCAGAGCCGAAGCCCCTTCCGCCACTGTTTGTGGCGCTTGGCCAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 0.40% | 12.91% | 30.45% | NA |
| All Indica | 2759 | 34.50% | 0.70% | 20.70% | 44.07% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.20% | 1.46% | NA |
| Aus | 269 | 25.30% | 0.00% | 8.92% | 65.80% | NA |
| Indica I | 595 | 45.20% | 0.20% | 17.31% | 37.31% | NA |
| Indica II | 465 | 37.00% | 0.60% | 10.11% | 52.26% | NA |
| Indica III | 913 | 27.40% | 1.00% | 26.83% | 44.80% | NA |
| Indica Intermediate | 786 | 33.30% | 0.80% | 22.39% | 43.51% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 4.17% | 13.54% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 8.89% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218417268 | G -> DEL | LOC_Os12g30660.1 | N | frameshift_variant | Average:25.034; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1218417268 | G -> A | LOC_Os12g30660.1 | missense_variant ; p.Ser232Asn; MODERATE | nonsynonymous_codon ; S232N | Average:25.034; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | benign |
1.386 |
TOLERATED | 0.12 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218417268 | NA | 7.24E-09 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218417268 | NA | 2.94E-07 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218417268 | 2.07E-06 | NA | mr1540_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218417268 | 2.25E-06 | 7.10E-10 | mr1540_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218417268 | 7.35E-06 | NA | mr1732_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218417268 | 7.22E-06 | 6.15E-09 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |