\
| Variant ID: vg1218365153 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18365153 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.35, others allele: 0.00, population size: 195. )
CTATGACGGGAAAGGGAAGGAGCGGAACGACGACGCTTAGGGTTATGCGACGGGTGGCGTTGCGTGCGAGAGGAAGAGGAGAGGAGTCGTGCGTGGCAGC[A/G]
TTGGGTAGGGGTGGGCGCGGAATCAACGACGCCGTTCGAGGTAGGGTTCCAGCTGTTGGGATACGCGTAGGCTACGATAGCATAAATCAAAATTTTCTAT
ATAGAAAATTTTGATTTATGCTATCGTAGCCTACGCGTATCCCAACAGCTGGAACCCTACCTCGAACGGCGTCGTTGATTCCGCGCCCACCCCTACCCAA[T/C]
GCTGCCACGCACGACTCCTCTCCTCTTCCTCTCGCACGCAACGCCACCCGTCGCATAACCCTAAGCGTCGTCGTTCCGCTCCTTCCCTTTCCCGTCATAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 30.10% | 0.06% | 0.19% | NA |
| All Indica | 2759 | 90.60% | 9.30% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 40.10% | 59.70% | 0.00% | 0.20% | NA |
| Aus | 269 | 36.80% | 62.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.60% | 18.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 93.50% | 6.20% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.30% | 92.30% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 45.60% | 53.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 30.00% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218365153 | A -> DEL | N | N | silent_mutation | Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg1218365153 | A -> G | LOC_Os12g30590.1 | upstream_gene_variant ; 4552.0bp to feature; MODIFIER | silent_mutation | Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg1218365153 | A -> G | LOC_Os12g30570.1 | downstream_gene_variant ; 3001.0bp to feature; MODIFIER | silent_mutation | Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg1218365153 | A -> G | LOC_Os12g30580.1 | downstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| vg1218365153 | A -> G | LOC_Os12g30580-LOC_Os12g30590 | intergenic_region ; MODIFIER | silent_mutation | Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218365153 | NA | 8.42E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 2.73E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 1.89E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 6.36E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 6.14E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 2.96E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 2.59E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 2.59E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 6.17E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | 3.74E-06 | 1.76E-08 | mr1992 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 2.88E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | 1.36E-06 | 1.16E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218365153 | NA | 1.19E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |