\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218365153:

Variant ID: vg1218365153 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18365153
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.35, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGACGGGAAAGGGAAGGAGCGGAACGACGACGCTTAGGGTTATGCGACGGGTGGCGTTGCGTGCGAGAGGAAGAGGAGAGGAGTCGTGCGTGGCAGC[A/G]
TTGGGTAGGGGTGGGCGCGGAATCAACGACGCCGTTCGAGGTAGGGTTCCAGCTGTTGGGATACGCGTAGGCTACGATAGCATAAATCAAAATTTTCTAT

Reverse complement sequence

ATAGAAAATTTTGATTTATGCTATCGTAGCCTACGCGTATCCCAACAGCTGGAACCCTACCTCGAACGGCGTCGTTGATTCCGCGCCCACCCCTACCCAA[T/C]
GCTGCCACGCACGACTCCTCTCCTCTTCCTCTCGCACGCAACGCCACCCGTCGCATAACCCTAAGCGTCGTCGTTCCGCTCCTTCCCTTTCCCGTCATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.10% 0.06% 0.19% NA
All Indica  2759 90.60% 9.30% 0.07% 0.07% NA
All Japonica  1512 40.10% 59.70% 0.00% 0.20% NA
Aus  269 36.80% 62.80% 0.00% 0.37% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 80.60% 18.90% 0.43% 0.00% NA
Indica III  913 93.50% 6.20% 0.00% 0.22% NA
Indica Intermediate  786 88.50% 11.50% 0.00% 0.00% NA
Temperate Japonica  767 60.00% 40.00% 0.00% 0.00% NA
Tropical Japonica  504 7.30% 92.30% 0.00% 0.40% NA
Japonica Intermediate  241 45.60% 53.90% 0.00% 0.41% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218365153 A -> DEL N N silent_mutation Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg1218365153 A -> G LOC_Os12g30590.1 upstream_gene_variant ; 4552.0bp to feature; MODIFIER silent_mutation Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg1218365153 A -> G LOC_Os12g30570.1 downstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg1218365153 A -> G LOC_Os12g30580.1 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg1218365153 A -> G LOC_Os12g30580-LOC_Os12g30590 intergenic_region ; MODIFIER silent_mutation Average:71.194; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218365153 NA 8.42E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 2.73E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 1.89E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 6.36E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 6.14E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 2.96E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 2.59E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 2.59E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 6.17E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 3.74E-06 1.76E-08 mr1992 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 2.88E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 1.36E-06 1.16E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218365153 NA 1.19E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251