Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218360623:

Variant ID: vg1218360623 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18360623
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTGGAATTTTCGGATTTTGTAAAAAAAATTTGAATTTGATCAAAGTTTATTCAAATACAATCAAAATTTATTATAATTTCTCGAAATCTCAAAATTTC[G/C]
TAAATTTCAGTGCCACCGAAATTTTGGCCGAAATTCGAAAGCGCAGCCCGTCCCCCTACTGGTGTGAGGGAGCGGGACACGGACACGCTAATCCGATCCG

Reverse complement sequence

CGGATCGGATTAGCGTGTCCGTGTCCCGCTCCCTCACACCAGTAGGGGGACGGGCTGCGCTTTCGAATTTCGGCCAAAATTTCGGTGGCACTGAAATTTA[C/G]
GAAATTTTGAGATTTCGAGAAATTATAATAAATTTTGATTGTATTTGAATAAACTTTGATCAAATTCAAATTTTTTTTACAAAATCCGAAAATTCCAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 6.00% 0.00% 0.00% NA
All Indica  2759 97.40% 2.60% 0.00% 0.00% NA
All Japonica  1512 94.20% 5.80% 0.00% 0.00% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 95.30% 4.70% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 73.40% 26.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218360623 G -> C LOC_Os12g30560.1 upstream_gene_variant ; 3494.0bp to feature; MODIFIER silent_mutation Average:80.067; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg1218360623 G -> C LOC_Os12g30570.1 upstream_gene_variant ; 375.0bp to feature; MODIFIER silent_mutation Average:80.067; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg1218360623 G -> C LOC_Os12g30580.1 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:80.067; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg1218360623 G -> C LOC_Os12g30555.1 downstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:80.067; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg1218360623 G -> C LOC_Os12g30560-LOC_Os12g30570 intergenic_region ; MODIFIER silent_mutation Average:80.067; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218360623 G C 0.05 0.02 0.01 0.01 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218360623 NA 6.20E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218360623 NA 1.56E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218360623 NA 4.57E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218360623 1.14E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218360623 5.30E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218360623 1.60E-07 NA mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251