\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218328298:

Variant ID: vg1218328298 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18328298
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGATCGTTGGATCTAACAATGCCCATCCTGCTAAGTTAGATCCAACGATCGGAAACGATTTGGTACCGTGAGGTACCGGTACCTCGAGGTACTTTTTG[C/T]
TAGACTTGAGCAAATCTCTTGTTTATTAGATGGTGAGAGGCTTTGAAAATTTTCCTTTTTCCTTTTGTTTTGCTGATGAGTATTTTTGAACGGTACTAAT

Reverse complement sequence

ATTAGTACCGTTCAAAAATACTCATCAGCAAAACAAAAGGAAAAAGGAAAATTTTCAAAGCCTCTCACCATCTAATAAACAAGAGATTTGCTCAAGTCTA[G/A]
CAAAAAGTACCTCGAGGTACCGGTACCTCACGGTACCAAATCGTTTCCGATCGTTGGATCTAACTTAGCAGGATGGGCATTGTTAGATCCAACGATCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 27.20% 0.55% 3.05% NA
All Indica  2759 52.70% 45.60% 0.58% 1.09% NA
All Japonica  1512 98.90% 0.90% 0.07% 0.07% NA
Aus  269 55.80% 0.40% 2.97% 40.89% NA
Indica I  595 90.80% 8.70% 0.50% 0.00% NA
Indica II  465 27.10% 71.60% 0.65% 0.65% NA
Indica III  913 40.30% 57.50% 0.55% 1.64% NA
Indica Intermediate  786 53.40% 44.40% 0.64% 1.53% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 85.60% 12.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218328298 C -> DEL N N silent_mutation Average:72.541; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1218328298 C -> T LOC_Os12g30520-LOC_Os12g30540 intergenic_region ; MODIFIER silent_mutation Average:72.541; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218328298 NA 9.91E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 7.47E-06 7.44E-06 mr1340 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 1.25E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 1.56E-07 NA mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 1.17E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 2.46E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 3.14E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 3.92E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 2.51E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 4.16E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 5.95E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 9.77E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 1.75E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 7.51E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 6.68E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218328298 NA 9.77E-06 mr1960_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251