\
| Variant ID: vg1218320965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18320965 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 213. )
TGGGGTAGTTAGGGGTGAACTAAACACAGCCTAAACAAGCCCTAAATGTTGGTGGAGACTAGAGAATGCACAAAAATGACTTCAGATGAATTTCGAAGGC[T/C]
TGAAAAGACATCCTACCATGTTTCCTAACGTACTCGTATGAATTTCGACAGGCTTGAAAAGACATACTACCCTGTTTCCTAATGTACTCGTATGACGTTG
CAACGTCATACGAGTACATTAGGAAACAGGGTAGTATGTCTTTTCAAGCCTGTCGAAATTCATACGAGTACGTTAGGAAACATGGTAGGATGTCTTTTCA[A/G]
GCCTTCGAAATTCATCTGAAGTCATTTTTGTGCATTCTCTAGTCTCCACCAACATTTAGGGCTTGTTTAGGCTGTGTTTAGTTCACCCCTAACTACCCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 33.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 52.80% | 47.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.20% | 75.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 13.80% | 86.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.00% | 34.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 54.70% | 45.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218320965 | T -> C | LOC_Os12g30520.1 | upstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:44.778; most accessible tissue: Callus, score: 72.615 | N | N | N | N |
| vg1218320965 | T -> C | LOC_Os12g30520-LOC_Os12g30540 | intergenic_region ; MODIFIER | silent_mutation | Average:44.778; most accessible tissue: Callus, score: 72.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218320965 | NA | 8.87E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320965 | NA | 5.39E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320965 | 2.85E-06 | 2.83E-06 | mr1954 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320965 | NA | 3.87E-08 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320965 | NA | 1.86E-08 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320965 | NA | 3.69E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |