| Variant ID: vg1218320197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18320197 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTGGGCATTAATTTTCTTTGGCTGCAGCACTATTCAAGGTCCAAAATTTTCATGGAAAGCTTCTTTATTTTAAATTAGGTCTTTGTTCCTTAAAAAAAA[G/A]
TAGGTGCGCTACCAAATAAAAAGTGCTATTTGCGAAAGGAACTCATAATTTATTATATGGAACTGACCTCAAGCATGGAGTTCTGGATTTTGTGATGCCA
TGGCATCACAAAATCCAGAACTCCATGCTTGAGGTCAGTTCCATATAATAAATTATGAGTTCCTTTCGCAAATAGCACTTTTTATTTGGTAGCGCACCTA[C/T]
TTTTTTTTAAGGAACAAAGACCTAATTTAAAATAAAGAAGCTTTCCATGAAAATTTTGGACCTTGAATAGTGCTGCAGCCAAAGAAAATTAATGCCCAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.00% | 0.40% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.20% | 1.30% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 2.60% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218320197 | G -> A | LOC_Os12g30520.1 | upstream_gene_variant ; 1130.0bp to feature; MODIFIER | silent_mutation | Average:45.521; most accessible tissue: Callus, score: 85.67 | N | N | N | N |
| vg1218320197 | G -> A | LOC_Os12g30520-LOC_Os12g30540 | intergenic_region ; MODIFIER | silent_mutation | Average:45.521; most accessible tissue: Callus, score: 85.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218320197 | NA | 5.52E-12 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1218320197 | 4.66E-06 | 1.38E-07 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320197 | NA | 3.06E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320197 | 2.72E-08 | 5.11E-09 | mr1274 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218320197 | NA | 3.11E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |