\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218294715:

Variant ID: vg1218294715 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18294715
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.49, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGCCCGACCTTGGCCGGGCCAACAACGGTGGCGTTCGAGTGCCACTCCCCTCTTGAGGGCGTTGTCATGCCGTCTCACCCCCTCTAGTGTGGCTGCCG[G/A]
ATGAAAGCCCAGTCTCAGTTCTCTTGGAGACCTTGACGGACGGCGGCGGCGGTGCTTTCGTCGCTTCTCTTTTTAAAGACATTGTCTAGGCACCCCTTGC

Reverse complement sequence

GCAAGGGGTGCCTAGACAATGTCTTTAAAAAGAGAAGCGACGAAAGCACCGCCGCCGCCGTCCGTCAAGGTCTCCAAGAGAACTGAGACTGGGCTTTCAT[C/T]
CGGCAGCCACACTAGAGGGGGTGAGACGGCATGACAACGCCCTCAAGAGGGGAGTGGCACTCGAACGCCACCGTTGTTGGCCCGGCCAAGGTCGGGCTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.10% 0.13% 0.00% NA
All Indica  2759 80.80% 19.10% 0.11% 0.00% NA
All Japonica  1512 41.10% 58.70% 0.20% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 67.60% 32.10% 0.34% 0.00% NA
Indica II  465 84.30% 15.50% 0.22% 0.00% NA
Indica III  913 85.90% 14.10% 0.00% 0.00% NA
Indica Intermediate  786 83.00% 17.00% 0.00% 0.00% NA
Temperate Japonica  767 61.10% 38.70% 0.13% 0.00% NA
Tropical Japonica  504 7.10% 92.50% 0.40% 0.00% NA
Japonica Intermediate  241 48.50% 51.50% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218294715 G -> A LOC_Os12g30460.1 upstream_gene_variant ; 3277.0bp to feature; MODIFIER silent_mutation Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1218294715 G -> A LOC_Os12g30480.1 downstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg1218294715 G -> A LOC_Os12g30460-LOC_Os12g30480 intergenic_region ; MODIFIER silent_mutation Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218294715 NA 1.32E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 6.97E-07 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 1.44E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 3.80E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 4.23E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 3.02E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 3.69E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 6.28E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 1.06E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 3.57E-06 7.05E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 1.46E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 NA 3.66E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715 5.19E-09 1.96E-12 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251