Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218294715:

Variant ID: vg1218294715 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18294715
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.49, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCCCGACCTTGGCCGGGCCAACAACGGTGGCGTTCGAGTGCCACTCCCCTCTTGAGGGCGTTGTCATGCCGTCTCACCCCCTCTAGTGTGGCTGCCG[G/A]
ATGAAAGCCCAGTCTCAGTTCTCTTGGAGACCTTGACGGACGGCGGCGGCGGTGCTTTCGTCGCTTCTCTTTTTAAAGACATTGTCTAGGCACCCCTTGC

Reverse complement sequence

GCAAGGGGTGCCTAGACAATGTCTTTAAAAAGAGAAGCGACGAAAGCACCGCCGCCGCCGTCCGTCAAGGTCTCCAAGAGAACTGAGACTGGGCTTTCAT[C/T]
CGGCAGCCACACTAGAGGGGGTGAGACGGCATGACAACGCCCTCAAGAGGGGAGTGGCACTCGAACGCCACCGTTGTTGGCCCGGCCAAGGTCGGGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	32.10%	0.13%	0.00%	NA
All Indica	2759	80.80%	19.10%	0.11%	0.00%	NA
All Japonica	1512	41.10%	58.70%	0.20%	0.00%	NA
Aus	269	93.70%	6.30%	0.00%	0.00%	NA
Indica I	595	67.60%	32.10%	0.34%	0.00%	NA
Indica II	465	84.30%	15.50%	0.22%	0.00%	NA
Indica III	913	85.90%	14.10%	0.00%	0.00%	NA
Indica Intermediate	786	83.00%	17.00%	0.00%	0.00%	NA
Temperate Japonica	767	61.10%	38.70%	0.13%	0.00%	NA
Tropical Japonica	504	7.10%	92.50%	0.40%	0.00%	NA
Japonica Intermediate	241	48.50%	51.50%	0.00%	0.00%	NA
VI/Aromatic	96	34.40%	65.60%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218294715	G -> A	LOC_Os12g30460.1	upstream_gene_variant ; 3277.0bp to feature; MODIFIER	silent_mutation	Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1218294715	G -> A	LOC_Os12g30480.1	downstream_gene_variant ; 3602.0bp to feature; MODIFIER	silent_mutation	Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg1218294715	G -> A	LOC_Os12g30460-LOC_Os12g30480	intergenic_region ; MODIFIER	silent_mutation	Average:64.372; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218294715	NA	1.32E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	6.97E-07	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	1.44E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	3.80E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	4.23E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	3.02E-07	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	3.69E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	6.28E-06	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	1.06E-06	mr1383	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	3.57E-06	7.05E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	1.46E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	NA	3.66E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218294715	5.19E-09	1.96E-12	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251