\
| Variant ID: vg1218290915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18290915 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAGCTGTCTTGCCTTTGTGATATGGAAGTGGGAAGCAGCGGCAAAGAAGTGGCCATATACTTTATTAGTTGAGCACAACTTAGGAAACTATTCTAATC[C/T]
CTCGAGAGGGGATGTTCCCTTCTTTACTTAAAAACCATATAAACGGTTATGAAAAATTCTGAAAAAATTTGGCAACATTCATACAACACATATATACAAC
GTTGTATATATGTGTTGTATGAATGTTGCCAAATTTTTTCAGAATTTTTCATAACCGTTTATATGGTTTTTAAGTAAAGAAGGGAACATCCCCTCTCGAG[G/A]
GATTAGAATAGTTTCCTAAGTTGTGCTCAACTAATAAAGTATATGGCCACTTCTTTGCCGCTGCTTCCCACTTCCATATCACAAAGGCAAGACAGCTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 30.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 75.20% | 24.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 54.90% | 45.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.00% | 40.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.90% | 21.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 27.60% | 72.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 36.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218290915 | C -> T | LOC_Os12g30460.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.922; most accessible tissue: Zhenshan97 flower, score: 76.106 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218290915 | NA | 5.53E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 7.95E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 1.29E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 7.49E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 2.54E-08 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 3.45E-06 | mr1492 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 9.53E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 8.33E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 1.12E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 5.54E-08 | mr1790_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218290915 | NA | 7.01E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |