Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218289979:

Variant ID: vg1218289979 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18289979
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, G: 0.46, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATAGTATGTTTGTAGAGATTGATATACATACCACAACAGAAATGAAGGGGCCAAGGATAAATATGATGAGGCAAAATTTGGGAAATTTTGTTTATGT[T/G]
ATACGAATGAGAGTCATCCTGAAAACGGTAACCACGCTAGCCAATGGGCCAAGCCAAATAGAATTTCGGACAAGTACAATGATTCACCAAATCATCTTAT

Reverse complement sequence

ATAAGATGATTTGGTGAATCATTGTACTTGTCCGAAATTCTATTTGGCTTGGCCCATTGGCTAGCGTGGTTACCGTTTTCAGGATGACTCTCATTCGTAT[A/C]
ACATAAACAAAATTTCCCAAATTTTGCCTCATCATATTTATCCTTGGCCCCTTCATTTCTGTTGTGGTATGTATATCAATCTCTACAAACATACTATTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.10%	0.49%	0.00%	NA
All Indica	2759	61.40%	38.00%	0.65%	0.00%	NA
All Japonica	1512	48.90%	50.90%	0.13%	0.00%	NA
Aus	269	72.10%	27.50%	0.37%	0.00%	NA
Indica I	595	42.40%	57.10%	0.50%	0.00%	NA
Indica II	465	78.90%	20.20%	0.86%	0.00%	NA
Indica III	913	63.20%	36.10%	0.66%	0.00%	NA
Indica Intermediate	786	63.20%	36.10%	0.64%	0.00%	NA
Temperate Japonica	767	69.60%	30.20%	0.13%	0.00%	NA
Tropical Japonica	504	23.00%	77.00%	0.00%	0.00%	NA
Japonica Intermediate	241	37.30%	62.20%	0.41%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	57.80%	40.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218289979	T -> G	LOC_Os12g30460.1	intron_variant ; MODIFIER	silent_mutation	Average:40.144; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218289979	NA	3.53E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	9.63E-07	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	8.27E-08	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	5.19E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	5.64E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.03E-08	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	2.12E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	9.63E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	6.39E-10	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	4.17E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.67E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	4.65E-08	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	4.45E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	3.80E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	7.80E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.59E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	9.39E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.85E-07	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	5.92E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.03E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	2.12E-11	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	4.29E-08	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	6.58E-09	mr1359_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	1.06E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	5.70E-06	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	7.78E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	7.59E-12	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218289979	NA	9.33E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251