\
| Variant ID: vg1218287578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18287578 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, T: 0.18, others allele: 0.00, population size: 186. )
AGCAAATGCTACTCATTATAAGGATTTCGACAAAGCAAATTTGTTCATCACTAAAGCCGAAGTCAATAGGAGTACTATTATGAATAAATTCAGACCTCAG[G/T]
CTCGAGGACGTAGTTCTCCCATAAATAAAACCATGTGTCATATAACAATTCTACTAAATATAGTAAGAGCATAGTTGAAAATGGTATTCGGTGCACTTTC
GAAAGTGCACCGAATACCATTTTCAACTATGCTCTTACTATATTTAGTAGAATTGTTATATGACACATGGTTTTATTTATGGGAGAACTACGTCCTCGAG[C/A]
CTGAGGTCTGAATTTATTCATAATAGTACTCCTATTGACTTCGGCTTTAGTGATGAACAAATTTGCTTTGTCGAAATCCTTATAATGAGTAGCATTTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 38.40% | 0.13% | 0.59% | NA |
| All Indica | 2759 | 40.80% | 58.30% | 0.07% | 0.76% | NA |
| All Japonica | 1512 | 99.00% | 0.70% | 0.07% | 0.20% | NA |
| Aus | 269 | 36.80% | 62.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 57.50% | 41.70% | 0.17% | 0.67% | NA |
| Indica II | 465 | 31.40% | 67.70% | 0.00% | 0.86% | NA |
| Indica III | 913 | 36.70% | 62.50% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 38.70% | 60.40% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 21.10% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218287578 | G -> DEL | LOC_Os12g30460.1 | N | frameshift_variant | Average:32.315; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| vg1218287578 | G -> T | LOC_Os12g30460.1 | missense_variant ; p.Pro106Thr; MODERATE | nonsynonymous_codon ; P106T | Average:32.315; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | unknown | unknown | TOLERATED | 0.26 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218287578 | NA | 2.40E-07 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 3.59E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 1.34E-09 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 5.68E-07 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 4.23E-09 | mr1056 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 6.32E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 1.17E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 9.35E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 9.99E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 2.30E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 3.58E-06 | mr1817 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 6.05E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 2.58E-06 | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 8.75E-07 | mr1359_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218287578 | NA | 8.18E-10 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |