\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218287520:

Variant ID: vg1218287520 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18287520
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.19, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TAAACCTCATGCCTTATCGAGCATCTTATCCCATCTTAAAGTTGGTTTATTCGGCAGCAGCAAATGCTACTCATTATAAGGATTTCGACAAAGCAAATTT[G/A]
TTCATCACTAAAGCCGAAGTCAATAGGAGTACTATTATGAATAAATTCAGACCTCAGGCTCGAGGACGTAGTTCTCCCATAAATAAAACCATGTGTCATA

Reverse complement sequence

TATGACACATGGTTTTATTTATGGGAGAACTACGTCCTCGAGCCTGAGGTCTGAATTTATTCATAATAGTACTCCTATTGACTTCGGCTTTAGTGATGAA[C/T]
AAATTTGCTTTGTCGAAATCCTTATAATGAGTAGCATTTGCTGCTGCCGAATAAACCAACTTTAAGATGGGATAAGATGCTCGATAAGGCATGAGGTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.30% 0.19% 0.51% NA
All Indica  2759 41.00% 58.20% 0.18% 0.62% NA
All Japonica  1512 98.90% 0.80% 0.07% 0.20% NA
Aus  269 36.80% 62.80% 0.00% 0.37% NA
Indica I  595 57.60% 41.70% 0.34% 0.34% NA
Indica II  465 31.60% 67.50% 0.22% 0.65% NA
Indica III  913 36.70% 62.50% 0.22% 0.55% NA
Indica Intermediate  786 38.80% 60.30% 0.00% 0.89% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 73.30% 21.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218287520 G -> DEL N N silent_mutation Average:30.692; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N
vg1218287520 G -> A LOC_Os12g30460.1 downstream_gene_variant ; 47.0bp to feature; MODIFIER silent_mutation Average:30.692; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N
vg1218287520 G -> A LOC_Os12g30450-LOC_Os12g30460 intergenic_region ; MODIFIER silent_mutation Average:30.692; most accessible tissue: Zhenshan97 young leaf, score: 48.658 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218287520 NA 2.91E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 7.37E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 9.60E-10 mr1031 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 4.75E-07 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 5.13E-09 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 1.63E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 1.43E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 6.97E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 6.81E-07 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 5.19E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218287520 NA 5.51E-07 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251