\
| Variant ID: vg1218283417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18283417 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, G: 0.23, others allele: 0.00, population size: 218. )
CACTCTCCGTGTAAAGGAAATTTGATCAATGATTTCTCACTTTGTTGATCCACGTGGAAGCAGAACGAACATTTTCATATTGAGAATATTTACAACTTCT[G/T]
CACCCATGCAAACCTTCTAGCATAGAATAAATTCAATTTTGTCTACAAATTTCACCCATCTACATGATCTCTACTCCTAACGTTAGCAATTTATGGCAGA
TCTGCCATAAATTGCTAACGTTAGGAGTAGAGATCATGTAGATGGGTGAAATTTGTAGACAAAATTGAATTTATTCTATGCTAGAAGGTTTGCATGGGTG[C/A]
AGAAGTTGTAAATATTCTCAATATGAAAATGTTCGTTCTGCTTCCACGTGGATCAACAAAGTGAGAAATCATTGATCAAATTTCCTTTACACGGAGAGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 38.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 69.90% | 30.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218283417 | G -> T | LOC_Os12g30460.1 | downstream_gene_variant ; 4150.0bp to feature; MODIFIER | silent_mutation | Average:31.299; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| vg1218283417 | G -> T | LOC_Os12g30450-LOC_Os12g30460 | intergenic_region ; MODIFIER | silent_mutation | Average:31.299; most accessible tissue: Zhenshan97 young leaf, score: 51.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218283417 | NA | 1.76E-28 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 2.73E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 7.51E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 4.60E-08 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 3.89E-09 | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 6.99E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 5.15E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 5.15E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 9.84E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 3.16E-12 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 3.63E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 8.67E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 2.39E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 5.71E-14 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 7.55E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218283417 | NA | 5.08E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |