\
| Variant ID: vg1218273231 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18273231 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 94. )
ATGGAAGACGGAGGCGACGAGGGAGATGGACGGCAACAGAGGCGGGGATGGATGGGAATGGCGTCGATACTGATAAATTACATAATACCCCTACGCGAAT[T/G]
ATGATCCTTGGACGAATATACCCCTCCACATATATATTACCACTAACTCTGGTGGGAGTAGAAATAGATCTCAATCCTACAATTAGATATGATCAACGAC
GTCGTTGATCATATCTAATTGTAGGATTGAGATCTATTTCTACTCCCACCAGAGTTAGTGGTAATATATATGTGGAGGGGTATATTCGTCCAAGGATCAT[A/C]
ATTCGCGTAGGGGTATTATGTAATTTATCAGTATCGACGCCATTCCCATCCATCCCCGCCTCTGTTGCCGTCCATCTCCCTCGTCGCCTCCGTCTTCCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 27.80% | 0.83% | 17.60% | NA |
| All Indica | 2759 | 52.70% | 45.60% | 0.29% | 1.49% | NA |
| All Japonica | 1512 | 50.20% | 1.00% | 1.65% | 47.16% | NA |
| Aus | 269 | 91.40% | 3.70% | 0.00% | 4.83% | NA |
| Indica I | 595 | 10.90% | 87.20% | 0.17% | 1.68% | NA |
| Indica II | 465 | 79.40% | 19.80% | 0.43% | 0.43% | NA |
| Indica III | 913 | 64.20% | 35.00% | 0.22% | 0.55% | NA |
| Indica Intermediate | 786 | 55.10% | 41.50% | 0.38% | 3.05% | NA |
| Temperate Japonica | 767 | 64.40% | 0.80% | 1.17% | 33.64% | NA |
| Tropical Japonica | 504 | 27.00% | 1.00% | 2.58% | 69.44% | NA |
| Japonica Intermediate | 241 | 53.50% | 1.70% | 1.24% | 43.57% | NA |
| VI/Aromatic | 96 | 32.30% | 12.50% | 5.21% | 50.00% | NA |
| Intermediate | 90 | 58.90% | 21.10% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218273231 | T -> DEL | N | N | silent_mutation | Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg1218273231 | T -> G | LOC_Os12g30444.1 | upstream_gene_variant ; 910.0bp to feature; MODIFIER | silent_mutation | Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg1218273231 | T -> G | LOC_Os12g30450.1 | downstream_gene_variant ; 230.0bp to feature; MODIFIER | silent_mutation | Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg1218273231 | T -> G | LOC_Os12g30450-LOC_Os12g30460 | intergenic_region ; MODIFIER | silent_mutation | Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218273231 | NA | 1.26E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 1.01E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 5.09E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 3.40E-06 | mr1269 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 2.03E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 5.79E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | 2.96E-06 | 2.96E-06 | mr1340 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | 8.18E-06 | 8.18E-06 | mr1429 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 7.70E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 7.67E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 6.99E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 7.62E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 3.82E-11 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 8.03E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218273231 | NA | 2.16E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |