\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218273231:

Variant ID: vg1218273231 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18273231
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAAGACGGAGGCGACGAGGGAGATGGACGGCAACAGAGGCGGGGATGGATGGGAATGGCGTCGATACTGATAAATTACATAATACCCCTACGCGAAT[T/G]
ATGATCCTTGGACGAATATACCCCTCCACATATATATTACCACTAACTCTGGTGGGAGTAGAAATAGATCTCAATCCTACAATTAGATATGATCAACGAC

Reverse complement sequence

GTCGTTGATCATATCTAATTGTAGGATTGAGATCTATTTCTACTCCCACCAGAGTTAGTGGTAATATATATGTGGAGGGGTATATTCGTCCAAGGATCAT[A/C]
ATTCGCGTAGGGGTATTATGTAATTTATCAGTATCGACGCCATTCCCATCCATCCCCGCCTCTGTTGCCGTCCATCTCCCTCGTCGCCTCCGTCTTCCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 27.80% 0.83% 17.60% NA
All Indica  2759 52.70% 45.60% 0.29% 1.49% NA
All Japonica  1512 50.20% 1.00% 1.65% 47.16% NA
Aus  269 91.40% 3.70% 0.00% 4.83% NA
Indica I  595 10.90% 87.20% 0.17% 1.68% NA
Indica II  465 79.40% 19.80% 0.43% 0.43% NA
Indica III  913 64.20% 35.00% 0.22% 0.55% NA
Indica Intermediate  786 55.10% 41.50% 0.38% 3.05% NA
Temperate Japonica  767 64.40% 0.80% 1.17% 33.64% NA
Tropical Japonica  504 27.00% 1.00% 2.58% 69.44% NA
Japonica Intermediate  241 53.50% 1.70% 1.24% 43.57% NA
VI/Aromatic  96 32.30% 12.50% 5.21% 50.00% NA
Intermediate  90 58.90% 21.10% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218273231 T -> DEL N N silent_mutation Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg1218273231 T -> G LOC_Os12g30444.1 upstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg1218273231 T -> G LOC_Os12g30450.1 downstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg1218273231 T -> G LOC_Os12g30450-LOC_Os12g30460 intergenic_region ; MODIFIER silent_mutation Average:46.198; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218273231 NA 1.26E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 1.01E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 5.09E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 3.40E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 2.03E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 5.79E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 2.96E-06 2.96E-06 mr1340 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 8.18E-06 8.18E-06 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 7.70E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 7.67E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 6.99E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 7.62E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 3.82E-11 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 8.03E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218273231 NA 2.16E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251